BBa_J23101 1 BBa_J23101 constitutive promoter family member 2006-08-03T11:00:00Z 2015-08-31T04:08:40Z later Released HQ 2013 later false true _52_ 0 483 95 In stock true N/A true John Anderson BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1686 1 T7 TE range1686 1 8 27 annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 annotation7020 1 BBa_B0012 range7020 1 1 41 BBa_K1523024 1 BBa_K1523024 Coding for Cr reductase 2014-04-18T11:00:00Z 2015-05-08T01:10:50Z It's from P.putida KT2440 GenBank:AF375642.1 It's a coding sequence of a kind of Cr(VI) reductase false false _1905_ 0 21246 9 It's complicated false We got it from the GenBank false Haotian Wang BBa_K1523008 1 BBa_K1523008 A device can reduce Cr(VI) 2014-04-18T11:00:00Z 2015-05-08T01:10:49Z P.putida It's a device which can reduce Cr(VI) false false _1905_ 0 21246 9 It's complicated false We combined K1523024 with some devices false Haotian Wang component2372539 1 BBa_B0012 component2372537 1 BBa_B0010 component2372533 1 BBa_J23101 component2372536 1 BBa_K1523024 component2372535 1 BBa_B0034 annotation2372536 1 BBa_K1523024 range2372536 1 62 622 annotation2372533 1 BBa_J23101 range2372533 1 1 35 annotation2372535 1 BBa_B0034 range2372535 1 44 55 annotation2372537 1 BBa_B0010 range2372537 1 631 710 annotation2372539 1 BBa_B0012 range2372539 1 719 759 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_B0034_sequence 1 aaagaggagaaa BBa_K1523008_sequence 1 tttacagctagctcagtcctaggtattatgctagctactagagaaagaggagaaatactagatgagccaggtgtattcggtagcagtcgtcgtgggcagcttgcgcaaggagtcctacaaccgcaaggtcgcccgcgcactttcggagctggcgccgtccagccttgcgctgaagatcgtcgagattggcgacctgccgctgtacaacgaagatatcgaagccgaggcaccgccggaaacctggaagcgttttcgcgatgaaatccgccgcagtgatgcggtgttgttcgtcaccccggaatacaaccgctcggtgccaggctgcctgaaaaatgccatcgatgtgggttcgcgtccttacgggcaaagtgcctggagcggcaagccgacggcggtggtgagtgtgtcgccgggggcgattggtggctttggcgccaaccatgcggtgcgccagtcgctggtgtttctcgacatgccctgcatgcagatgcccgaggcttaccttggcggtgcggcgagcttgttcgaggattcgggcaagctcaatgacaagacgcgaccgttcttgcaggcgtttgtcgacaggtttgcgtcatgggtgaagttgaacagggcggtctgatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_J23101_sequence 1 tttacagctagctcagtcctaggtattatgctagc BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_K1523024_sequence 1 atgagccaggtgtattcggtagcagtcgtcgtgggcagcttgcgcaaggagtcctacaaccgcaaggtcgcccgcgcactttcggagctggcgccgtccagccttgcgctgaagatcgtcgagattggcgacctgccgctgtacaacgaagatatcgaagccgaggcaccgccggaaacctggaagcgttttcgcgatgaaatccgccgcagtgatgcggtgttgttcgtcaccccggaatacaaccgctcggtgccaggctgcctgaaaaatgccatcgatgtgggttcgcgtccttacgggcaaagtgcctggagcggcaagccgacggcggtggtgagtgtgtcgccgggggcgattggtggctttggcgccaaccatgcggtgcgccagtcgctggtgtttctcgacatgccctgcatgcagatgcccgaggcttaccttggcggtgcggcgagcttgttcgaggattcgggcaagctcaatgacaagacgcgaccgttcttgcaggcgtttgtcgacaggtttgcgtcatgggtgaagttgaacagggcggtctga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z