BBa_K1523102 1 BBa_K1523102 The translational unit of yieF 2014-12-14T12:00:00Z 2015-05-08T01:10:50Z It's a coding sequence of a kind of Cr(VI) reductase yieF Catalytic activity NAD(P)H + a quinone = NAD(P)+ + a hydroquinone. 2 NAD(P)H + Cr6+ + O2 = 2 NAD(P)+ + Cr3+ + H2O2 true false _1905_ 0 21246 9 Discontinued false false Haotian Wang component2430293 1 BBa_J23100 annotation2430293 1 BBa_J23100 range2430293 1 1 35 BBa_J23100 1 BBa_J23100 constitutive promoter family member 2006-08-03T11:00:00Z 2015-08-31T04:08:40Z Isolated from library of promoters Released HQ 2013 Replace later false true _52_ 0 483 95 In stock true N/A true John Anderson BBa_J23100_sequence 1 ttgacggctagctcagtcctaggtacagtgctagc BBa_K1523102_sequence 1 ttgacggctagctcagtcctaggtacagtgctagc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z