BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_B0015 1 BBa_B0015 double terminator (B0010-B0012) 2003-07-16T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator consisting of BBa_B0010 and BBa_B0012 false true _1_ 0 24 7 In stock false true Reshma Shetty component1916612 1 BBa_B0012 component1916610 1 BBa_B0010 annotation1916610 1 BBa_B0010 range1916610 1 1 80 annotation1916612 1 BBa_B0012 range1916612 1 89 129 BBa_K1523024 1 BBa_K1523024 Coding for Cr reductase 2014-04-18T11:00:00Z 2015-05-08T01:10:50Z It's from P.putida KT2440 GenBank:AF375642.1 It's a coding sequence of a kind of Cr(VI) reductase false false _1905_ 0 21246 9 It's complicated false We got it from the GenBank false Haotian Wang BBa_J23100 1 BBa_J23100 constitutive promoter family member 2006-08-03T11:00:00Z 2015-08-31T04:08:40Z Isolated from library of promoters Released HQ 2013 Replace later false true _52_ 0 483 95 In stock true N/A true John Anderson BBa_B0031 1 BBa_B0031 RBS.2 (weak) -- derivative of BBa_0030 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Medium RBS based on Ron Weiss thesis. Strength considered relative to <bb_part>BBa_B0030</bb_part>, <bb_part>BBa_B0032</bb_part>, <bb_part>BBa_B0033</bb_part>. false true _41_44_48_46_1_ 0 24 7 In stock false <P> <P>Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix (&quot;RBS-1&quot; in figure 4-14 of thesis). <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. <P> Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Cho</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23316 1 conserved range23316 1 7 10 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 annotation1686 1 T7 TE range1686 1 8 27 annotation7020 1 BBa_B0012 range7020 1 1 41 BBa_K1523103 1 BBa_K1523103 The translational unit of yieF 2014-12-14T12:00:00Z 2015-05-08T01:10:50Z It's a coding sequence of a kind of Cr(VI) reductase yieF Catalytic activity NAD(P)H + a quinone = NAD(P)+ + a hydroquinone. 2 NAD(P)H + Cr6+ + O2 = 2 NAD(P)+ + Cr3+ + H2O2 false false _1905_ 0 21246 9 Not in stock false false Haotian Wang component2430297 1 BBa_K1523024 component2430304 1 BBa_B0015 component2430296 1 BBa_B0031 component2430294 1 BBa_J23100 annotation2430297 1 BBa_K1523024 range2430297 1 64 624 annotation2430296 1 BBa_B0031 range2430296 1 44 57 annotation2430304 1 BBa_B0015 range2430304 1 633 761 annotation2430294 1 BBa_J23100 range2430294 1 1 35 BBa_J23100_sequence 1 ttgacggctagctcagtcctaggtacagtgctagc BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_K1523103_sequence 1 ttgacggctagctcagtcctaggtacagtgctagctactagagtcacacaggaaacctactagatgagccaggtgtattcggtagcagtcgtcgtgggcagcttgcgcaaggagtcctacaaccgcaaggtcgcccgcgcactttcggagctggcgccgtccagccttgcgctgaagatcgtcgagattggcgacctgccgctgtacaacgaagatatcgaagccgaggcaccgccggaaacctggaagcgttttcgcgatgaaatccgccgcagtgatgcggtgttgttcgtcaccccggaatacaaccgctcggtgccaggctgcctgaaaaatgccatcgatgtgggttcgcgtccttacgggcaaagtgcctggagcggcaagccgacggcggtggtgagtgtgtcgccgggggcgattggtggctttggcgccaaccatgcggtgcgccagtcgctggtgtttctcgacatgccctgcatgcagatgcccgaggcttaccttggcggtgcggcgagcttgttcgaggattcgggcaagctcaatgacaagacgcgaccgttcttgcaggcgtttgtcgacaggtttgcgtcatgggtgaagttgaacagggcggtctgatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0031_sequence 1 tcacacaggaaacc BBa_K1523024_sequence 1 atgagccaggtgtattcggtagcagtcgtcgtgggcagcttgcgcaaggagtcctacaaccgcaaggtcgcccgcgcactttcggagctggcgccgtccagccttgcgctgaagatcgtcgagattggcgacctgccgctgtacaacgaagatatcgaagccgaggcaccgccggaaacctggaagcgttttcgcgatgaaatccgccgcagtgatgcggtgttgttcgtcaccccggaatacaaccgctcggtgccaggctgcctgaaaaatgccatcgatgtgggttcgcgtccttacgggcaaagtgcctggagcggcaagccgacggcggtggtgagtgtgtcgccgggggcgattggtggctttggcgccaaccatgcggtgcgccagtcgctggtgtttctcgacatgccctgcatgcagatgcccgaggcttaccttggcggtgcggcgagcttgttcgaggattcgggcaagctcaatgacaagacgcgaccgttcttgcaggcgtttgtcgacaggtttgcgtcatgggtgaagttgaacagggcggtctga BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0015_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z