BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_K1529000 1 BBa_K1529000 YdeD 2014-09-11T11:00:00Z 2015-05-08T01:10:50Z 1 1 false false _1911_ 0 22687 9 Not in stock false 1 false Riku Shinohara BBa_K1529001 1 BBa_K1529001 rbs_ydeD 2014-09-11T11:00:00Z 2015-05-08T01:10:50Z 1 1 false false _1911_ 0 22687 9 Not in stock false 1 false Riku Shinohara component2382974 1 BBa_K1529000 component2382973 1 BBa_B0034 annotation2382973 1 BBa_B0034 range2382973 1 1 12 annotation2382974 1 BBa_K1529000 range2382974 1 21 24 BBa_K1529000_sequence 1 atag BBa_B0034_sequence 1 aaagaggagaaa BBa_K1529001_sequence 1 aaagaggagaaatactagagatag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z