BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_K1529010 1 BBa_K1529010 yfiK 2014-09-11T11:00:00Z 2015-05-08T01:10:50Z 1 1 false false _1911_ 0 22687 9 Not in stock false 1 false Riku Shinohara BBa_R0040 1 p(tetR) TetR repressible promoter 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z Lutz, R., Bujard, H., <em>Nucleic Acids Research</em> (1997) 25, 1203-1210. Released HQ 2013 Sequence for pTet inverting regulator driven by the TetR protein.</P> false true _1_ 0 24 7 In stock false <P> <P>BBa_R0040 TetR-Regulated Promoter is based on a cI promoter. It has been modified to include two TetR binding sites and the BioBrick standard assembly head and tail restriction sites.<P> true June Rhee, Connie Tao, Ty Thomson, Louis Waldman annotation1986784 1 BBa_R0040 range1986784 1 1 54 annotation1986783 1 TetR 1 range1986783 1 1 19 annotation1986786 1 TetR 2 range1986786 1 26 44 annotation1986787 1 -10 range1986787 1 43 48 annotation1986785 1 -35 range1986785 1 20 25 BBa_K1529012 1 BBa_K1529012 Ptet_rbs_yfiK 2014-09-11T11:00:00Z 2015-05-08T01:10:50Z 1 1 false false _1911_ 0 22687 9 Not in stock false 1 false Riku Shinohara component2383151 1 BBa_K1529011 component2383143 1 BBa_R0040 annotation2383151 1 BBa_K1529011 range2383151 1 63 92 annotation2383143 1 BBa_R0040 range2383143 1 1 54 BBa_K1529011 1 BBa_K1529011 rbs_yfiK 2014-09-11T11:00:00Z 2015-05-08T01:10:50Z 1 1 false false _1911_ 0 22687 9 Not in stock false 1 false Riku Shinohara component2383142 1 BBa_K1529010 component2383141 1 BBa_B0034 annotation2383142 1 BBa_K1529010 range2383142 1 21 30 annotation2383141 1 BBa_B0034 range2383141 1 1 12 BBa_K1529011_sequence 1 aaagaggagaaatactagagtagatatata BBa_K1529012_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcactactagagaaagaggagaaatactagagtagatatata BBa_B0034_sequence 1 aaagaggagaaa BBa_R0040_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcac BBa_K1529010_sequence 1 tagatatata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z