BBa_K1529996 1 BBa_K1529996 1 2014-08-29T11:00:00Z 2015-05-08T01:10:51Z 3 2 false false _1911_ 0 22677 9 Not in stock false 4 false Kino Yuta component2381840 1 BBa_B0040 component2381834 1 BBa_R0040 annotation2381834 1 BBa_R0040 range2381834 1 1 54 annotation2381840 1 BBa_B0040 range2381840 1 63 132 BBa_B0040 1 spacer Spacer.1 (generic) 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Randomly generated and optimized for several parameters (see Design notes). Released HQ 2013 Generic spacer for ensuring a 70 bp distance between the end of the suffix of the BioBrick part containing the double terminator and the prefix of the BioBrick part containing the promoter of the new gene. Please, use the AlignX function of Vector NT to check for homology with the components in your plasmid before using this spacer.</P> false false _1_ 0 24 7 In stock false <P> <P><p>The size of the spacer was choosed to meet the minimum length of a sequence that can be queried using the BLAST search engine. However, subsequences of it can be used to design shorter spacers. The sequence was selected from many more sequences randomly generated using the <a href="http://www.lifesci.ucsb.edu/~maduro/random.htm">Random DNA Generator </a>engine; the GC% parameter used as input was 50%. The sequences were selected based on the following constraints listed in their order of importance: the absence of any putative promoter regions, a low degree of homology with the Elowitz plasmid (whose components are widely used in our designs), no homology with other <em>E.coli</em> sequences as shown by BLASTN search results and the presence of a number of TAA stop codons. The second constraint was the most stringent leading to the elimination of most sequences. </p> <p> DE made the following changes to the original sequence in order to add stop codons in the -3 frame and more in the +2 frame (note, not all of these stop codons are UAA. Thus, if used in an organism that inserts an amino acid @ UGA or UAG the obvious will occur):<br> T->A @ 85<br> T->A @ 42<br> C->T @ 79<br> A->T @ 64<br> A->T @ 31<br> T->A @ 34<br> C->A @ 37<br> Also, note that the above changes further reduce (the already very weak) homology to current NCBI-stored sequences.<br> </p> <P>In the process of selecting the best sequence it appeared that a good alternative sequence for a spacer would be: AGGTTCTGATATGTAACTGTGCCCAATGTCGTTAGTGACGCATACCTCTTAAGAGGCCACTGTCCTAACA. The sequence contains no putative promoters and shows moderate homology with the 5' end of the Ampicillin resistance gene. However a strong promoter sequence starts 12 bp downstream of this sequence, and therefore the sequence presented above was preferred. </p><P> The sequence is compatible (does not show significant homology) with the components in the Elowitz repressilator plasmid. true Vinay S. Mahajan, Brian Chow, Peter Carr annotation1721 1 Spacer-1 range1721 1 1 70 annotation7030 1 BBa_B0040 range7030 1 1 70 BBa_R0040 1 p(tetR) TetR repressible promoter 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z Lutz, R., Bujard, H., <em>Nucleic Acids Research</em> (1997) 25, 1203-1210. Released HQ 2013 Sequence for pTet inverting regulator driven by the TetR protein.</P> false true _1_ 0 24 7 In stock false <P> <P>BBa_R0040 TetR-Regulated Promoter is based on a cI promoter. It has been modified to include two TetR binding sites and the BioBrick standard assembly head and tail restriction sites.<P> true June Rhee, Connie Tao, Ty Thomson, Louis Waldman annotation1986786 1 TetR 2 range1986786 1 26 44 annotation1986787 1 -10 range1986787 1 43 48 annotation1986783 1 TetR 1 range1986783 1 1 19 annotation1986784 1 BBa_R0040 range1986784 1 1 54 annotation1986785 1 -35 range1986785 1 20 25 BBa_B0040_sequence 1 aggttctgttaagtaactgaacccaatgtcgttagtgacgcttacctcttaagaggtcactgacctaaca BBa_R0040_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcac BBa_K1529996_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcactactagagaggttctgttaagtaactgaacccaatgtcgttagtgacgcttacctcttaagaggtcactgacctaaca igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z