BBa_K1531004 1 BBa_K1531004 Bovine beta casein (B variant) with full alpha-factor yeast secretion signal 2014-10-12T11:00:00Z 2015-05-08T01:10:51Z Bos taurus sequence, from http://www.ncbi.nlm.nih.gov/protein/AAI11173.1 Beta casein is one of four major caseins (cheese proteins) found in bovine cheese. Together with Kappa casein, it is necessary and sufficient to create casein micelles. At least 12 different genetic variants of bovine Beta casein have been identified and characterized. The B allele used here is associated with improved milk coagulation. The coding sequence for this gene is preceded by a secretion signal derived from the yeast mating pheromone alpha-factor in Saccharomyces cerevisiae, facilitates secretion of heterologous proteins in yeast. We used a full length form of the full alpha-factor protein with kex and ste13 protease cleavage sites (FAKS). (www.pnas.org/content/81/15/4642.short). In addition, the entire construct is flanked by SapI restriction sites, for cloning into DNA2.0's Electra system. false false _1913_ 0 11141 9 It's complicated false The DNA sequence was codon optimized for expression in S. cerevisiae, using IDT's codon optimization tools, followed by manual editing of a few codons to avoid specific restriction sites. false Patrik D annotation2418013 1 start codon range2418013 1 9 11 annotation2418015 1 bovine Beta casein range2418015 1 276 905 annotation2418016 1 stop codon range2418016 1 903 905 annotation2418014 1 alpha factor yeast secretion signal range2418014 1 12 275 annotation2418012 1 Sap1 range2418012 1 1 11 annotation2418017 1 SapI range2418017 1 906 916 BBa_K1531004_sequence 1 gctcttctatgagattcccatctattttcaccgctgtcttgttcgctgcctcctctgcattggctgcccctgttaacactaccactgaagacgagactgctcaaattccagctgaagcagttatcggttactctgaccttgagggtgatttcgacgtcgctgttttgcctttctctaactccactaacaacggtttgttgttcattaacaccactatcgcttccattgctgctaaggaagagggtgtctctctcgagaaaagagaggccgaagctagagaattggaagaactaaacgtgcccggggaaatagtcgaatccctttcttcaagcgaagaatcaattacaagaattaacaagaagattgaaaagtttcaatctgaagaacaacagcaaactgaagatgagttgcaggataagattcatccattcgcccaaacacagagtttggtgtatccattccctggtcctatccataattccttgcctcaaaacatccctcccctgacacagactcctgttgttgtcccacctttcctgcaacctgaagttatgggtgtttctaaagtgaaagaagccatggctcctaagcataaagaaatgccatttcctaagtacccagtcgagcccttcacagaaagacagtctttgacactaacagacgtggagaatctgcacttgcctcttccactgcttcaaagctggatgcatcaaccacatcaaccacttccaccaactgtcatgtttcccccacaaagcgtcctaagcttgtctcaaagcaaagtactaccagtaccacaaaaagcggtaccctatcctcagagagatatgcctattcaagcatttctgctttaccaagaacctgtcttaggaccagtaagaggtcccttcccaattattgtgtagggtagaagagc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z