BBa_K1531005 1 BBa_K1531005 Bovine kappa casein (B variant) with full alpha-factor yeast secretion signal 2014-10-10T11:00:00Z 2015-05-08T01:10:51Z Bos taurus sequence, from http://www.ncbi.nlm.nih.gov/protein/AAQ87923.1 Kappa casein is one of four major caseins (cheese proteins) found in bovine cheese. It serves a key function in the formation and coagulation of casein micelles in milk. Kappa casein has a hydrophobic head and a hydrophilic tail, causing it to coat and stabilize the casein micelle. Chymosin (one of the main enzymes in rennet, used to make cheese from milk) cleave the hydrophilic tails off the Kappa casein, causing the micelles to cluster together in a 3D gel network that we call cheese. At least 11 different genetic variants of bovine Kappa casein have been identified and characterized, with some of them being associated with differences in coagulation time, and/or health effects. We have decided to focus on the B allele, which is associated with improved milk coagulation, and potential health benefits. The coding sequence for this gene is preceeded by a full yeast alpha factor, for secretion of the protein product out of the yeast cell. In addition, the entire construct is flanked by SapI restriction sites, for cloning into with DNA2.0' Electra system. false false _1913_ 0 11141 9 It's complicated false The DNA sequence was codon optimized for expression in S. cerevisiae, using IDT's codon optimization tools, followed by manual editing of a few codons to avoid specific restriction sites. false Patrik D annotation2418005 1 stop codon range2418005 1 783 785 annotation2418003 1 alpha factor yeast secretion signal range2418003 1 12 275 annotation2418006 1 SapI range2418006 1 786 796 annotation2418004 1 bovine Kappa casein range2418004 1 276 785 annotation2418002 1 start codon range2418002 1 9 11 annotation2418001 1 SapI range2418001 1 1 11 BBa_K1531005_sequence 1 gctcttctatgagattcccatctattttcaccgctgtcttgttcgctgcctcctctgcattggctgcccctgttaacactaccactgaagacgagactgctcaaattccagctgaagcagttatcggttactctgaccttgagggtgatttcgacgtcgctgttttgcctttctctaactccactaacaacggtttgttgttcattaacaccactatcgcttccattgctgctaaggaagagggtgtctctctcgagaaaagagaggccgaagctcaagaacaaaatcaagaacagccaatcagatgtgagaaggatgaaaggtttttttctgataagatagcgaagtacatacctatccaatacgttttatctcgttaccctagttacgggttgaactattatcaacaaaaacctgtagctctaataaacaatcagtttcttccttacccttactacgccaaaccggctgccgttagatcaccggcacaaattttgcaatggcaagtgttgtctaacactgttcccgctaaatcttgtcaagcccagcccacaacaatggcaaggcacccacatccacacctatcattcatggccattccacctaagaaaaatcaagataagactgagatccctacaattaacacgatcgcatcaggagaaccgacatctaccccaacaatcgaggctgttgagagtaccgttgcgactttggaagcatctccagaagtgattgaatccccgccagaaatcaatacggtccaagtgacttctactgctgtctagggtagaagagc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z