BBa_J23104 1 BBa_J23104 constitutive promoter family member 2006-08-03T11:00:00Z 2015-08-31T04:08:40Z isolated from library of promoters replace later false false _52_ 0 483 95 In stock true N/A true John Anderson BBa_K608003 1 BBa_K608003 strong Promoter , medium RBS 2011-09-14T11:00:00Z 2015-05-08T01:12:52Z composite Released HQ 2013 strong Promotor , medium RBS false false _780_ 0 9115 9 In stock false composite false Julia M??ller component2128649 1 BBa_J23104 component2128651 1 BBa_B0032 annotation2128651 1 BBa_B0032 range2128651 1 44 56 annotation2128649 1 BBa_J23104 range2128649 1 1 35 BBa_B0015 1 BBa_B0015 double terminator (B0010-B0012) 2003-07-16T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator consisting of BBa_B0010 and BBa_B0012 false true _1_ 0 24 7 In stock false true Reshma Shetty component1916612 1 BBa_B0012 component1916610 1 BBa_B0010 annotation1916612 1 BBa_B0012 range1916612 1 89 129 annotation1916610 1 BBa_B0010 range1916610 1 1 80 BBa_B0032 1 BBa_B0032 RBS.3 (medium) -- derivative of BBa_0030 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Weak1 RBS based on Ron Weiss thesis. Strength is considered relative to <bb_part>BBa_B0030</bb_part>, <bb_part>BBa_B0031</bb_part>, <bb_part>BBa_B0033</bb_part>. false true _41_44_48_46_1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix (&quot;RBS-2&quot; in figure 4-14 of thesis). <P> Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation1709 1 RBS-3\Weak range1709 1 1 13 annotation1710 1 RBS range1710 1 7 10 annotation7027 1 BBa_B0032 range7027 1 1 13 BBa_C0012 1 lacI lacI repressor from E. coli (+LVA) 2003-01-31T12:00:00Z 2015-08-31T04:07:23Z represillator of Elowitz and Leibler (2000) Released HQ 2013 Coding region for the LacI protein with an LVA degradation tail and without an RBS. LacI binds to the pLac regulator <bb_part>BBa_R0010</bb_part> and PLlac01 hybrid regulator <bb_part>BBa_R0011</bb_part> and inhibits transcription. IPTG (Isopropylthiogalactoside) binds to LacI and inhibits its operation, therefore promoting transcription.</P> <P>A rapid degredation tail (LVA) has been added to improve the High to Low performance of this part.</P> false false _1_ 0 24 7 In stock false References (unparsed) here: <p>Elowitz, M.B., Leibler, S. A synthetic oscillatory network of transcriptional regulators. <em>Nature</em> 403, 335-338 (2000). <a href="http://biobricks.ai.mit.edu/BB_References.htm#ELOW00">[ELOW00]</a><br> <br> </P> <P> References (unparsed) here: <p>Elowitz, M.B., Leibler, S. A synthetic oscillatory network of transcriptional regulators. <em>Nature</em> 403, 335-338 (2000). <a href="http://biobricks.ai.mit.edu/BB_References.htm#ELOW00">[ELOW00]</a><br> <br> </P> <P>Sequence taken from the repressilator of Elowitz and Leibler (2000). The obtained sequence was compared to the wild-type sequence for LacI obtained through a database search. The sequence had been modified from the wild-type in that wild-type GTG start was changed to an ATG start (note, actual ORF in E.coli has several GTG starts it would seem). The LVA tag has been added for quicker degradation.<P> Incompatible with systems containing LacI, lactose, or IPTG. true Grace Kenney, Daniel Shen, Neelaksh Varshney, Samantha Sutton annotation2213988 1 Help:Barcodes range2213988 1 1129 1153 annotation1722 1 LVA range1722 1 1090 1128 annotation7031 1 BBa_C0012 range7031 1 1 1128 annotation1723 1 lacI-LVA range1723 1 1 1128 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1686 1 T7 TE range1686 1 8 27 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 BBa_K1532007 1 BBa_K1532007 LacI Producer 2014-10-03T11:00:00Z 2015-05-08T01:10:52Z This part is assembled with standard bio-bricks from the distribution with the standard assembly protocol This part contains a LacI CDS led by a constitutive promoter. false false _1914_ 0 21134 9 It's complicated true N/A false Xinyuan Qiu, Miyang Li component2393780 1 BBa_K608003 component2393782 1 BBa_C0012 component2393791 1 BBa_B0015 annotation2393780 1 BBa_K608003 range2393780 1 1 56 annotation2393791 1 BBa_B0015 range2393791 1 1224 1352 annotation2393782 1 BBa_C0012 range2393782 1 63 1190 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_K1532007_sequence 1 ttgacagctagctcagtcctaggtattgtgctagctactagagtcacacaggaaagtactagatggtgaatgtgaaaccagtaacgttatacgatgtcgcagagtatgccggtgtctcttatcagaccgtttcccgcgtggtgaaccaggccagccacgtttctgcgaaaacgcgggaaaaagtggaagcggcgatggcggagctgaattacattcccaaccgcgtggcacaacaactggcgggcaaacagtcgttgctgattggcgttgccacctccagtctggccctgcacgcgccgtcgcaaattgtcgcggcgattaaatctcgcgccgatcaactgggtgccagcgtggtggtgtcgatggtagaacgaagcggcgtcgaagcctgtaaagcggcggtgcacaatcttctcgcgcaacgcgtcagtgggctgatcattaactatccgctggatgaccaggatgccattgctgtggaagctgcctgcactaatgttccggcgttatttcttgatgtctctgaccagacacccatcaacagtattattttctcccatgaagacggtacgcgactgggcgtggagcatctggtcgcattgggtcaccagcaaatcgcgctgttagcgggcccattaagttctgtctcggcgcgtctgcgtctggctggctggcataaatatctcactcgcaatcaaattcagccgatagcggaacgggaaggcgactggagtgccatgtccggttttcaacaaaccatgcaaatgctgaatgagggcatcgttcccactgcgatgctggttgccaacgatcagatggcgctgggcgcaatgcgcgccattaccgagtccgggctgcgcgttggtgcggatatctcggtagtgggatacgacgataccgaagacagctcatgttatatcccgccgttaaccaccatcaaacaggattttcgcctgctggggcaaaccagcgtggaccgcttgctgcaactctctcagggccaggcggtgaagggcaatcagctgttgcccgtctcactggtgaaaagaaaaaccaccctggcgcccaatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcaggctgcaaacgacgaaaactacgctttagtagcttaataactctgatagtgctagtgtagatctctactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_K608003_sequence 1 ttgacagctagctcagtcctaggtattgtgctagctactagagtcacacaggaaag BBa_B0032_sequence 1 tcacacaggaaag BBa_C0012_sequence 1 atggtgaatgtgaaaccagtaacgttatacgatgtcgcagagtatgccggtgtctcttatcagaccgtttcccgcgtggtgaaccaggccagccacgtttctgcgaaaacgcgggaaaaagtggaagcggcgatggcggagctgaattacattcccaaccgcgtggcacaacaactggcgggcaaacagtcgttgctgattggcgttgccacctccagtctggccctgcacgcgccgtcgcaaattgtcgcggcgattaaatctcgcgccgatcaactgggtgccagcgtggtggtgtcgatggtagaacgaagcggcgtcgaagcctgtaaagcggcggtgcacaatcttctcgcgcaacgcgtcagtgggctgatcattaactatccgctggatgaccaggatgccattgctgtggaagctgcctgcactaatgttccggcgttatttcttgatgtctctgaccagacacccatcaacagtattattttctcccatgaagacggtacgcgactgggcgtggagcatctggtcgcattgggtcaccagcaaatcgcgctgttagcgggcccattaagttctgtctcggcgcgtctgcgtctggctggctggcataaatatctcactcgcaatcaaattcagccgatagcggaacgggaaggcgactggagtgccatgtccggttttcaacaaaccatgcaaatgctgaatgagggcatcgttcccactgcgatgctggttgccaacgatcagatggcgctgggcgcaatgcgcgccattaccgagtccgggctgcgcgttggtgcggatatctcggtagtgggatacgacgataccgaagacagctcatgttatatcccgccgttaaccaccatcaaacaggattttcgcctgctggggcaaaccagcgtggaccgcttgctgcaactctctcagggccaggcggtgaagggcaatcagctgttgcccgtctcactggtgaaaagaaaaaccaccctggcgcccaatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcaggctgcaaacgacgaaaactacgctttagtagcttaataactctgatagtgctagtgtagatctc BBa_J23104_sequence 1 ttgacagctagctcagtcctaggtattgtgctagc BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0015_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z