BBa_K1537017 1 BBa_K1537017 GSG linker+T2A 2014-09-15T11:00:00Z 2015-05-08T01:10:52Z T2A is from Thosea asigna virus. The 18~22 amino acids 2A self-cleaving oligopeptides can be used for co-expression of multiple, discrete proteins from a single ORF.Based on highly inefficient peptide bond formation between glycine and proline residues within the 2A peptide, placement of 2A peptide sequence as a linker region between tandem cDNA???s allows the stoichiometric translation of multiple unfused protein products. These sequences were first discovered in the foot-and-mouth disease virus (FMDV).And since than many 2A-like sequences have been identified in other viruses and some parasites.To minimize the risk of homologous recombination, it is important to use different 2A peptide sequences if more than two genes are being linked. The 2A peptide system has thus far worked successfully in all eukaryotic systems tested, from mammalian cells, yeast, and plants.In our project,we use F2A(from foot-and-mouth disease virus), P2A(from porcine teschovirus-1) and T2A(from Thosea asigna virus) to achieve our goal.And GSG linker is an oligopeptide of ???Gly-Ser-Gly??? between your protein and 2A peptide to enhance cleavage. false false _1919_ 0 22415 9 In stock false We have to use it by chemosynthesis because the virus is dangerous. false Jie Li annotation2383711 1 T2A range2383711 1 10 63 annotation2383712 1 GSG linker range2383712 1 1 9 BBa_K1537017_sequence 1 ggtagtggagagggtagaggatctcttttgacatgtggagatgttgaagagaaccctggacca igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z