BBa_K1539055 1 HE Promote HE Promoter Primer 2014-10-09T11:00:00Z 2015-05-08T01:10:52Z Primers ordered from IDT This primer can be used to insert a high efficiency promoter to translate E. coli. genes. Must be used after insertion of RBS primer. Use Georgia Tech iGEM RBS primers (BBa_K1539021 or BBa_K1539034) or an RBS primer with a similar design. false false _1921_ 0 23019 9 Not in stock false Primer design could not retain the EcoRI site but once the construct (promoter->RBS->gene) is reinserted into pSB1C3 backbone, EcoRI is site is reestablished. false Coleen Tran BBa_K1539055_sequence 1 cgcggccgcttctagagttgacagctagctcagtcctaggtactgtgctagcaaagag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z