BBa_K1545000 1 BBa_K1545000 1xGFP1 decoy 2014-10-08T11:00:00Z 2015-05-08T01:10:53Z synthesized Array of 1 binding site for gRNAs matching CCATCTAATTCAACAAGAATTGG + 7 bp spacer false false _1928_ 0 23396 9 In stock false n/a false Mike Zhu annotation2407646 1 GFP1 binding site + NGG range2407646 1 1 24 BBa_K1545000_sequence 1 ccatctaattcaacaagaattggtgatgttaat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z