BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_K1550000 1 BBa_K1550000 Metallothionein with RBS and tt 2014-10-16T11:00:00Z 2015-05-08T01:10:53Z The sequences for pre-existing basic parts (BBa_B0034 and BBa_B0015) were incorporated as found in the iGEM registry. The sequence used for the BmtA (metallothionein) was codon optimized for E. coli (using the browser-based software, Gene Design). The native sequence comes from Oscillatoria brevis, and was sourced from an entry in the NCBI database by Liu,T., Nakashima,S., Hirose,K., Uemura,Y., Shibasaka,M., Katsuhara,M. and Kasamo,K. (2003). This part includes the strong RBS BBa_B0034 (Elowitz, 1999), BmtA from Oscillatoria brevis, which encodes lead binding metallothionein (Liu et al., 2003), and the double transcription terminator BBa_B0015. The BmtA sequence in this part has been codon optimized for E. coli. This part can be used with a constitutive or inducible promoter to produce metallothionein in projects utilizing the metal-binding protein for sequestration purposes. true false _1934_ 0 23749 9 Discontinued false When used in E. coli for the sequestration of lead or zinc ions in solution, the part may or may not work better in concert with a genomic ZntA knockout. We plan to characterize this combination in the near future. false Jesse Goldenberg component2426961 1 BBa_B0034 component2426963 1 BBa_B0034 annotation2426961 1 BBa_B0034 range2426961 1 1 12 annotation2426963 1 BBa_B0034 range2426963 1 21 32 BBa_K1550000_sequence 1 aaagaggagaaatactagagaaagaggagaaa BBa_B0034_sequence 1 aaagaggagaaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z