BBa_K1550004 1 BBa_K1550004 BmtA (Lead/Zinc-binding metallothionein from Oscillatoria brevis, codon optimized for E. coli) 2014-10-16T11:00:00Z 2015-08-03T03:05:43Z The sequence used for the BmtA (metallothionein) was codon optimized for E. coli (using the browser-based software, Gene Design). The native sequence comes from Oscillatoria brevis, and was sourced from an entry in the NCBI database by Liu,T., Nakashima,S., Hirose,K., Uemura,Y., Shibasaka,M., Katsuhara,M. and Kasamo,K. (2003). This is the BmtA coding sequence from Oscillatoria brevis, which encodes lead and zinc binding metallothionein (Liu et al., 2003). The BmtA sequence in this part has been codon optimized for E. coli. This part can be used with a constitutive or inducible promoter to produce metallothionein in projects utilizing the metal-binding protein for sequestration purposes. false false _1934_ 4206 23749 9 Not in stock false When used in E. coli for the sequestration of lead or zinc ions in solution, the part may or may not work better in concert with a genomic ZntA knockout. We plan to characterize this combination in the near future. false Jesse Goldenberg BBa_K1550004_sequence 1 atgaccaccgttacccagatcaaatgcgcttgcccgtcttgcctgtgcgttgtttctctgaccgaagctatcgaaaaatctggtaaatcttactgctcttctgcttgcgctgacggtcacccgaacggtaccggttgcggtcacaccggttgcgaatgccacaaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z