BBa_B0015 1 BBa_B0015 double terminator (B0010-B0012) 2003-07-16T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator consisting of BBa_B0010 and BBa_B0012 false true _1_ 0 24 7 In stock false true Reshma Shetty component1916610 1 BBa_B0010 component1916612 1 BBa_B0012 annotation1916610 1 BBa_B0010 range1916610 1 1 80 annotation1916612 1 BBa_B0012 range1916612 1 89 129 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1687 1 stop range1687 1 34 34 annotation1686 1 T7 TE range1686 1 8 27 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1690 1 polya range1690 1 28 41 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_K1550004 1 BBa_K1550004 BmtA (Lead/Zinc-binding metallothionein from Oscillatoria brevis, codon optimized for E. coli) 2014-10-16T11:00:00Z 2015-08-03T03:05:43Z The sequence used for the BmtA (metallothionein) was codon optimized for E. coli (using the browser-based software, Gene Design). The native sequence comes from Oscillatoria brevis, and was sourced from an entry in the NCBI database by Liu,T., Nakashima,S., Hirose,K., Uemura,Y., Shibasaka,M., Katsuhara,M. and Kasamo,K. (2003). This is the BmtA coding sequence from Oscillatoria brevis, which encodes lead and zinc binding metallothionein (Liu et al., 2003). The BmtA sequence in this part has been codon optimized for E. coli. This part can be used with a constitutive or inducible promoter to produce metallothionein in projects utilizing the metal-binding protein for sequestration purposes. false false _1934_ 4206 23749 9 Not in stock false When used in E. coli for the sequestration of lead or zinc ions in solution, the part may or may not work better in concert with a genomic ZntA knockout. We plan to characterize this combination in the near future. false Jesse Goldenberg BBa_K1550010 1 BBa_K1550010 BmtA (metallothionein) codon optimized for E. coli, with RBS and tt 2014-10-16T11:00:00Z 2015-05-08T01:10:53Z The sequences for pre-existing basic parts besides K1550004 (BBa_B0034 and BBa_B0015) were incorporated as found in the iGEM registry. The sequence used for the BmtA (metallothionein) was codon optimized for E. coli (using the browser-based software, Gene Design). The native sequence comes from Oscillatoria brevis, and was sourced from an entry in the NCBI database by Liu,T., Nakashima,S., Hirose,K., Uemura,Y., Shibasaka,M., Katsuhara,M. and Kasamo,K. (2003). This part includes the strong RBS BBa_B0034 (Elowitz, 1999), BBa_K1550004 [BmtA from Oscillatoria brevis, which encodes lead binding metallothionein (Liu et al., 2003)], and the double transcription terminator BBa_B0015. The BmtA sequence in this part has been codon optimized for E. coli. This part can be used with a constitutive or inducible promoter to produce metallothionein in projects utilizing the metal-binding protein for sequestration purposes. false false _1934_ 0 23749 9 Not in stock false When used in E. coli for the sequestration of lead or zinc ions in solution, the part may or may not work better in concert with a genomic ZntA knockout. We plan to characterize this combination in the near future. false Jesse Goldenberg component2427033 1 BBa_B0034 component2427041 1 BBa_B0015 component2427034 1 BBa_K1550004 annotation2427041 1 BBa_B0015 range2427041 1 192 320 annotation2427034 1 BBa_K1550004 range2427034 1 19 183 annotation2427033 1 BBa_B0034 range2427033 1 1 12 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_K1550004_sequence 1 atgaccaccgttacccagatcaaatgcgcttgcccgtcttgcctgtgcgttgtttctctgaccgaagctatcgaaaaatctggtaaatcttactgctcttctgcttgcgctgacggtcacccgaacggtaccggttgcggtcacaccggttgcgaatgccacaaa BBa_K1550010_sequence 1 aaagaggagaaatactagatgaccaccgttacccagatcaaatgcgcttgcccgtcttgcctgtgcgttgtttctctgaccgaagctatcgaaaaatctggtaaatcttactgctcttctgcttgcgctgacggtcacccgaacggtaccggttgcggtcacaccggttgcgaatgccacaaatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0034_sequence 1 aaagaggagaaa BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0015_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z