BBa_K156001 1 BBa_K156001 BioBrick Placeholder 1 (Prefix - ApoI (NotI) AvrII - Suffix) 2008-10-27T12:00:00Z 2015-05-08T01:10:54Z The DNA sequence is simply linked restriction enzyme sites that are compatible with standard BBa restriction sites. These compatible sites were compiled and listed in "Engineering BioBrick vectors from BioBrick parts". http://www.jbioleng.org/content/2/1/5 This BioBrick Placeholder part is the first of eight and represents a new technical standard useful in composite part construction. These parts are made of restriction sites that are compatible with the standard BBa sites (see below) and serve as placeholders for future inserts (e.g., RBSs, coding regions). This allows insertion of a desired part within a previously-made construct. Compatible sites: EcoRI - ApoI & MfeI X & S - AvrII, NheI PstI - NsiI, SbfI false false _246_ 0 1475 9 It's complicated false Sites are compatible with standard BBa restriction sites and will form scars when ligated. false George McArthur IV BBa_K156001_sequence 1 gaattcgcggccgcttctagagaaattcgcggccgccctaggtactagtagcggccgctgcag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z