BBa_K156006 1 BBa_K156006 BioBrick placeholder 6 (Prefix - MfeI (NotI) NheI - Suffix) 2008-10-27T12:00:00Z 2015-05-08T01:10:54Z The DNA sequence is simply linked restriction enzyme sites that are compatible with standard BBa restriction sites. These compatible sites were compiled and listed in "Engineering BioBrick vectors from BioBrick parts". http://www.jbioleng.org/content/2/1/5 This BioBrick Placeholder part is one of a set of eight that represent a new technical standard useful in composite part construction. Flanked by the standard BBa restriction sites, these parts are made of internal restriction sites that are unique but compatible with the standard sites (see below). This allows insertion of a desired part (e.g., RBSs, coding regions) within a previously-made construct. Compatible sites: EcoRI - ApoI & MfeI <br /> XbaI & SpeI - AvrII, NheI <br /> PstI - NsiI, SbfI <br /> false false _246_ 0 1475 9 It's complicated false Sites are compatible with standard BBa restriction sites and will form scars when ligated. false George McArthur IV BBa_K156006_sequence 1 gaattcgcggccgcttctagagcaattggcggccgcgctagctactagtagcggccgctgcag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z