BBa_B0032 1 BBa_B0032 RBS.3 (medium) -- derivative of BBa_0030 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Weak1 RBS based on Ron Weiss thesis. Strength is considered relative to <bb_part>BBa_B0030</bb_part>, <bb_part>BBa_B0031</bb_part>, <bb_part>BBa_B0033</bb_part>. false true _41_44_48_46_1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix (&quot;RBS-2&quot; in figure 4-14 of thesis). <P> Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation1709 1 RBS-3\Weak range1709 1 1 13 annotation7027 1 BBa_B0032 range7027 1 1 13 annotation1710 1 RBS range1710 1 7 10 BBa_K156013 1 Bioplastic phaB1 (acetyacetyl-CoA reductase) 2008-10-28T12:00:00Z 2015-05-08T01:10:54Z This coding region is native to Ralstonia eutropha H16. The original sequence was obtained from GenBank (VERSION NC_008313.1, GI:113866031). This part codes for an enzyme that catalyzes the formation of 3-hydroxybutyryl-CoA from acetoacetyl-CoA in polyhydroxyalkanoate synthesis. false false _246_ 0 1475 9 It's complicated false This part was codon-optimized for expression in E. coli. The following restriction enzyme sites were also removed: EcoRI, NotI, XbaI, SpeI, PstI, NheI, AvrII, ApoI, MfeI, NsiI, SbfI. false George McArthur IV BBa_K156019 1 BBa_K156019 Promoter + RBS + phaB1 2008-10-28T12:00:00Z 2015-05-08T01:10:54Z This is a composite part. This composite part is made of a promoter, a standard ribosomal binding site and a part codes for an enzyme that catalyzes the formation of 3-hydroxybutyryl-CoA from acetoacetyl-CoA in polyhydroxyalkanoate synthesis. false false _246_ 0 1475 9 Not in stock false None. false George McArthur IV component1993672 1 BBa_B0032 component1993666 1 BBa_R0040 component1993674 1 BBa_K156013 annotation1993674 1 BBa_K156013 range1993674 1 82 822 annotation1993666 1 BBa_R0040 range1993666 1 1 54 annotation1993672 1 BBa_B0032 range1993672 1 63 75 BBa_R0040 1 p(tetR) TetR repressible promoter 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z Lutz, R., Bujard, H., <em>Nucleic Acids Research</em> (1997) 25, 1203-1210. Released HQ 2013 Sequence for pTet inverting regulator driven by the TetR protein.</P> false true _1_ 0 24 7 In stock false <P> <P>BBa_R0040 TetR-Regulated Promoter is based on a cI promoter. It has been modified to include two TetR binding sites and the BioBrick standard assembly head and tail restriction sites.<P> true June Rhee, Connie Tao, Ty Thomson, Louis Waldman annotation1986787 1 -10 range1986787 1 43 48 annotation1986786 1 TetR 2 range1986786 1 26 44 annotation1986783 1 TetR 1 range1986783 1 1 19 annotation1986784 1 BBa_R0040 range1986784 1 1 54 annotation1986785 1 -35 range1986785 1 20 25 BBa_K156013_sequence 1 atgactcaacgtatcgcatatgtaactggtggtatgggtggtatcggtactgcaatttgccagcgtctggcgaaagacggtttccgtgttgttgcgggctgcggtccgaactccccgcgtcgtgaaaagtggctggaacaacagaaagccctgggcttcgacttcattgcctccgagggtaatgtagctgactgggattccaccaagactgccttcgataaagttaaatctgaagtgggcgaagtagatgtactgatcaacaacgccggtattactcgtgatgtcgtattccgcaaaatgacccgtgcagactgggatgcagttatcgacaccaacctgacgtctctgttcaacgttaccaaacaggttattgatggtatggctgaccgtggctggggccgcatcgtgaacatctctagcgttaacggccaaaaaggccaatttggtcagacgaattacagcacggctaaagcaggcctgcacggtttcaccatggcactggcgcaggaagtggcgaccaaaggtgttaccgttaataccgtttctccaggttacatcgccaccgatatggttaaggctatccgccaagatgttctggacaagatcgtggctaccattccggttaaacgcctgggcctgccggaagaaattgcgtccatctgtgcgtggctgagctccgaagagtctggtttttccaccggtgcggatttctctctgaacggtggtctgcacatgggttga BBa_R0040_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcac BBa_K156019_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcactactagagtcacacaggaaagtactagatgactcaacgtatcgcatatgtaactggtggtatgggtggtatcggtactgcaatttgccagcgtctggcgaaagacggtttccgtgttgttgcgggctgcggtccgaactccccgcgtcgtgaaaagtggctggaacaacagaaagccctgggcttcgacttcattgcctccgagggtaatgtagctgactgggattccaccaagactgccttcgataaagttaaatctgaagtgggcgaagtagatgtactgatcaacaacgccggtattactcgtgatgtcgtattccgcaaaatgacccgtgcagactgggatgcagttatcgacaccaacctgacgtctctgttcaacgttaccaaacaggttattgatggtatggctgaccgtggctggggccgcatcgtgaacatctctagcgttaacggccaaaaaggccaatttggtcagacgaattacagcacggctaaagcaggcctgcacggtttcaccatggcactggcgcaggaagtggcgaccaaaggtgttaccgttaataccgtttctccaggttacatcgccaccgatatggttaaggctatccgccaagatgttctggacaagatcgtggctaccattccggttaaacgcctgggcctgccggaagaaattgcgtccatctgtgcgtggctgagctccgaagagtctggtttttccaccggtgcggatttctctctgaacggtggtctgcacatgggttga BBa_B0032_sequence 1 tcacacaggaaag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z