BBa_K156022 1 BBa_K156022 Promoter + RBS + phaB1 + double terminator 2008-10-28T12:00:00Z 2015-05-08T01:10:54Z This is a composite part. This device is a synthetic gene that generates PhaA, an enzyme that catalyzes the formation of 3-hydroxybutyryl-CoA from acetoacetyl-CoA in polyhydroxyalkanoate synthesis. false false _246_ 0 1475 9 It's complicated false No special design considerations. false George McArthur IV component1993818 1 BBa_K156013 component1993819 1 BBa_B0010 component1993810 1 BBa_R0040 component1993821 1 BBa_B0012 component1993816 1 BBa_B0032 annotation1993816 1 BBa_B0032 range1993816 1 63 75 annotation1993819 1 BBa_B0010 range1993819 1 831 910 annotation1993818 1 BBa_K156013 range1993818 1 82 822 annotation1993821 1 BBa_B0012 range1993821 1 919 959 annotation1993810 1 BBa_R0040 range1993810 1 1 54 BBa_B0032 1 BBa_B0032 RBS.3 (medium) -- derivative of BBa_0030 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Weak1 RBS based on Ron Weiss thesis. Strength is considered relative to <bb_part>BBa_B0030</bb_part>, <bb_part>BBa_B0031</bb_part>, <bb_part>BBa_B0033</bb_part>. false true _41_44_48_46_1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix (&quot;RBS-2&quot; in figure 4-14 of thesis). <P> Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation1709 1 RBS-3\Weak range1709 1 1 13 annotation7027 1 BBa_B0032 range7027 1 1 13 annotation1710 1 RBS range1710 1 7 10 BBa_K156013 1 Bioplastic phaB1 (acetyacetyl-CoA reductase) 2008-10-28T12:00:00Z 2015-05-08T01:10:54Z This coding region is native to Ralstonia eutropha H16. The original sequence was obtained from GenBank (VERSION NC_008313.1, GI:113866031). This part codes for an enzyme that catalyzes the formation of 3-hydroxybutyryl-CoA from acetoacetyl-CoA in polyhydroxyalkanoate synthesis. false false _246_ 0 1475 9 It's complicated false This part was codon-optimized for expression in E. coli. The following restriction enzyme sites were also removed: EcoRI, NotI, XbaI, SpeI, PstI, NheI, AvrII, ApoI, MfeI, NsiI, SbfI. false George McArthur IV BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1686 1 T7 TE range1686 1 8 27 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 BBa_R0040 1 p(tetR) TetR repressible promoter 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z Lutz, R., Bujard, H., <em>Nucleic Acids Research</em> (1997) 25, 1203-1210. Released HQ 2013 Sequence for pTet inverting regulator driven by the TetR protein.</P> false true _1_ 0 24 7 In stock false <P> <P>BBa_R0040 TetR-Regulated Promoter is based on a cI promoter. It has been modified to include two TetR binding sites and the BioBrick standard assembly head and tail restriction sites.<P> true June Rhee, Connie Tao, Ty Thomson, Louis Waldman annotation1986784 1 BBa_R0040 range1986784 1 1 54 annotation1986787 1 -10 range1986787 1 43 48 annotation1986785 1 -35 range1986785 1 20 25 annotation1986783 1 TetR 1 range1986783 1 1 19 annotation1986786 1 TetR 2 range1986786 1 26 44 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_K156013_sequence 1 atgactcaacgtatcgcatatgtaactggtggtatgggtggtatcggtactgcaatttgccagcgtctggcgaaagacggtttccgtgttgttgcgggctgcggtccgaactccccgcgtcgtgaaaagtggctggaacaacagaaagccctgggcttcgacttcattgcctccgagggtaatgtagctgactgggattccaccaagactgccttcgataaagttaaatctgaagtgggcgaagtagatgtactgatcaacaacgccggtattactcgtgatgtcgtattccgcaaaatgacccgtgcagactgggatgcagttatcgacaccaacctgacgtctctgttcaacgttaccaaacaggttattgatggtatggctgaccgtggctggggccgcatcgtgaacatctctagcgttaacggccaaaaaggccaatttggtcagacgaattacagcacggctaaagcaggcctgcacggtttcaccatggcactggcgcaggaagtggcgaccaaaggtgttaccgttaataccgtttctccaggttacatcgccaccgatatggttaaggctatccgccaagatgttctggacaagatcgtggctaccattccggttaaacgcctgggcctgccggaagaaattgcgtccatctgtgcgtggctgagctccgaagagtctggtttttccaccggtgcggatttctctctgaacggtggtctgcacatgggttga BBa_K156022_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcactactagagtcacacaggaaagtactagatgactcaacgtatcgcatatgtaactggtggtatgggtggtatcggtactgcaatttgccagcgtctggcgaaagacggtttccgtgttgttgcgggctgcggtccgaactccccgcgtcgtgaaaagtggctggaacaacagaaagccctgggcttcgacttcattgcctccgagggtaatgtagctgactgggattccaccaagactgccttcgataaagttaaatctgaagtgggcgaagtagatgtactgatcaacaacgccggtattactcgtgatgtcgtattccgcaaaatgacccgtgcagactgggatgcagttatcgacaccaacctgacgtctctgttcaacgttaccaaacaggttattgatggtatggctgaccgtggctggggccgcatcgtgaacatctctagcgttaacggccaaaaaggccaatttggtcagacgaattacagcacggctaaagcaggcctgcacggtttcaccatggcactggcgcaggaagtggcgaccaaaggtgttaccgttaataccgtttctccaggttacatcgccaccgatatggttaaggctatccgccaagatgttctggacaagatcgtggctaccattccggttaaacgcctgggcctgccggaagaaattgcgtccatctgtgcgtggctgagctccgaagagtctggtttttccaccggtgcggatttctctctgaacggtggtctgcacatgggttgatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_R0040_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcac BBa_B0032_sequence 1 tcacacaggaaag BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z