BBa_B0030 1 BBa_B0030 RBS.1 (strong) -- modified from R. Weiss 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Strong RBS based on Ron Weiss thesis. Strength is considered relative to <bb_part>BBa_B0031</bb_part>, <bb_part>BBa_B0032</bb_part>, <bb_part>BBa_B0033</bb_part>. false true _44_46_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix (&quot;orig&quot; in figure 4-14 of Ron Weiss thesis). <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation1702 1 RBS range1702 1 8 12 annotation7025 1 BBa_B0030 range7025 1 1 15 annotation1701 1 RBS-1\Strong range1701 1 1 15 BBa_K1565000 1 BBa_K1565000 This part is a colorimetric indicator of cell lysis 2014-10-08T11:00:00Z 2015-05-08T01:10:54Z This part consists of biobricks registry. As an inducible promoter nucleic acid, a strong RBS, a blue chromoprotein and a double terminator. This part is a colorimetric indicator of oleic acid-inducible cell lysis. In cell lysis process, the release of oleic acid, which stimulate the promoter to produce blue chromoprotein occurs. The production of blue color, indicating cell lysis. false false _1951_ 0 22300 9 It's complicated false The biobrick was designed with parts already tested the registry, so the tests were to observe the operation of the new design. false Deborah M Landim Zanforlin component2408522 1 BBa_K592009 component2408519 1 BBa_B0030 component2408530 1 BBa_K823017 component2408517 1 BBa_K817002 annotation2408519 1 BBa_B0030 range2408519 1 81 95 annotation2408522 1 BBa_K592009 range2408522 1 102 770 annotation2408530 1 BBa_K823017 range2408530 1 779 873 annotation2408517 1 BBa_K817002 range2408517 1 1 72 BBa_K817002 1 BBa_K817002 PfadBA 2012-09-17T11:00:00Z 2015-05-08T01:13:28Z de novo synthesis Released HQ 2013 Fatty acid sensitive promoter false false _1075_ 0 13572 9 In stock false N/A false Yi-Te Lee, Chieh-Mei Wang annotation2197686 1 PfadBA range2197686 1 1 72 BBa_B0014 1 BBa_B0014 double terminator (B0012-B0011) 2003-07-15T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator consisting of BBa_B0012 and BBa_B0011 false true _1_ 0 24 7 In stock false true Reshma Shetty component939303 1 BBa_B0012 component939311 1 BBa_B0011 annotation939303 1 BBa_B0012 range939303 1 1 41 annotation939311 1 BBa_B0011 range939311 1 50 95 BBa_K592009 1 amilCP amilCP, blue chromoprotein 2011-09-17T11:00:00Z 2015-05-08T01:12:48Z Acropora millepora Released HQ 2013 This chromoprotein, amilCP, naturally exhibits very strong color when expressed. The color is blue/purple and is visible to naked eye, thereby requiring no instruments to observe. This DNA was provided by Jeffrey Miller at UCLA. It was made BioBrick-compatible after removal of one illegal internal restriction site (EcoRI). false false _763_ 0 7929 9 In stock true Illegal internal restriction site had to be removed (EcoRI). false Lei Sun annotation2131628 1 amilCP range2131628 1 1 666 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1690 1 polya range1690 1 28 41 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 annotation1686 1 T7 TE range1686 1 8 27 BBa_K823017 1 BBa_K823017 double terminator (B0012-B0011) 2012-09-10T11:00:00Z 2015-05-08T01:13:30Z Part:BBa_B0014 Released HQ 2013 This is a copy of the [[Part:B0014|Part:B0014]]. Only here the part is cloned in the standard vector pSB1C3 instead of the pSB1AK3. false false _1081_ 0 11555 9 In stock false This is a copy of the [[Part:B0014|Part:B0014]]. Only here the part is cloned in the standard vector pSB1C3 instead of the pSB1AK3. false Jara Radeck component2182657 1 BBa_B0014 annotation2182657 1 BBa_B0014 range2182657 1 1 95 BBa_B0011 1 BBa_B0011 LuxICDABEG (+/-) 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from luxICDABEG operon terminator of Vibrio fischeri <genbank>AF170104</genbank>. Released HQ 2013 Bidirectional transcriptional terminator consisting of a 22 bp stem-loop.</p> false false _1_ 0 24 7 In stock false <P> <P>In the naturally-occuring sequence there is a mismatch in the stem of the stem loop. This can be corrected via an A-&gt;G mutation (at position 40 -- sequence coordinate/not MFOLD coordinate). The above sequence does not reflect this mutation (but the MFOLD image does). This terminator's location cannot be found using some inverted repeat detectors like PALINDROME because it is too short and contains a mismatch. This one was found with the help of Tom Knight. It lies between two coding regions that point towards eachother.<P> true Reshma Shetty annotation7019 1 BBa_B0011 range7019 1 1 46 annotation1683 1 stem_loop range1683 1 13 35 BBa_B0014_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttatatactagagagagaatataaaaagccagattattaatccggcttttttattattt BBa_B0030_sequence 1 attaaagaggagaaa BBa_K823017_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttatatactagagagagaatataaaaagccagattattaatccggcttttttattattt BBa_K817002_sequence 1 atctggtacgaccagatttgacaatctggtacgaccagatgatactgagcacatcagcaggacgcactgacc BBa_K592009_sequence 1 atgagtgtgatcgctaaacaaatgacctacaaggtttatatgtcaggcacggtcaatggacactactttgaggtcgaaggcgatggaaaaggtaagccctacgagggggagcagacggtaaagctcactgtcaccaagggcggacctctgccatttgcttgggatattttatcaccacagtgtcagtacggaagcataccattcaccaagtaccctgaagacatccctgactatgtaaagcagtcattcccggagggctatacatgggagaggatcatgaactttgaagatggtgcagtgtgtactgtcagcaatgattccagcatccaaggcaactgtttcatctaccatgtcaagttctctggtttgaactttcctcccaatggacctgtcatgcagaagaagacacagggctgggaacccaacactgagcgtctctttgcacgagatggaatgctgctaggaaacaactttatggctctgaagttagaaggaggcggtcactatttgtgtgaatttaaaactacttacaaggcaaagaagcctgtgaagatgccagggtatcactatgttgaccgcaaactggatgtaaccaatcacaacaaggattacacttcggttgagcagtgtgaaatttccattgcacgcaaacctgtggtcgcctaataa BBa_K1565000_sequence 1 atctggtacgaccagatttgacaatctggtacgaccagatgatactgagcacatcagcaggacgcactgacctactagagattaaagaggagaaatactagatgagtgtgatcgctaaacaaatgacctacaaggtttatatgtcaggcacggtcaatggacactactttgaggtcgaaggcgatggaaaaggtaagccctacgagggggagcagacggtaaagctcactgtcaccaagggcggacctctgccatttgcttgggatattttatcaccacagtgtcagtacggaagcataccattcaccaagtaccctgaagacatccctgactatgtaaagcagtcattcccggagggctatacatgggagaggatcatgaactttgaagatggtgcagtgtgtactgtcagcaatgattccagcatccaaggcaactgtttcatctaccatgtcaagttctctggtttgaactttcctcccaatggacctgtcatgcagaagaagacacagggctgggaacccaacactgagcgtctctttgcacgagatggaatgctgctaggaaacaactttatggctctgaagttagaaggaggcggtcactatttgtgtgaatttaaaactacttacaaggcaaagaagcctgtgaagatgccagggtatcactatgttgaccgcaaactggatgtaaccaatcacaacaaggattacacttcggttgagcagtgtgaaatttccattgcacgcaaacctgtggtcgcctaataatactagagtcacactggctcaccttcgggtgggcctttctgcgtttatatactagagagagaatataaaaagccagattattaatccggcttttttattattt BBa_B0011_sequence 1 agagaatataaaaagccagattattaatccggcttttttattattt BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z