BBa_K554002 1 BBa_K554002 HlyA secretion signal peptide 2011-09-20T11:00:00Z 2015-05-08T01:12:40Z Synthesized sequence. Released HQ 2013 HylA is ... false false _722_ 0 7971 9 In stock true false UNICAMP EMSE Brazil team annotation2136841 1 Stop range2136841 1 181 186 annotation2136840 1 HlyA range2136840 1 1 180 BBa_K1565002 1 BBa_K1565002 ColiAlert 2014-10-09T11:00:00Z 2015-05-08T01:10:54Z This biobrick is formed by other biobricks the registry. This part is responsible for the pink coloration of E. coli. E. coli transformed with this biobrick becomes pink in neutral and basic medium (LB culture medium for example). However, cultures can change color to yellow (instantly) with the acidification of the medium. Another factor that makes the medium yellow, is the addition of cell lysis buffer. The cells lysed immediately becomes yellow, while those that are not lysed remain pink. Thus, this biobrick can be used as an indicator of cell lysis. false false _1951_ 0 22300 9 It's complicated true The design was thought to expression of yellow coloration. However, in basic medium, there expressing pink color. false Deborah M Landim Zanforlin, Roberta Godone, Mirella Monteiro component2415911 1 BBa_B0015 component2415899 1 BBa_I746361 component2415902 1 BBa_K554002 component2415904 1 BBa_K1033910 annotation2415899 1 BBa_I746361 range2415899 1 1 92 annotation2415911 1 BBa_B0015 range2415911 1 1015 1143 annotation2415902 1 BBa_K554002 range2415902 1 101 286 annotation2415904 1 BBa_K1033910 range2415904 1 293 1006 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1690 1 polya range1690 1 28 41 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 annotation1686 1 T7 TE range1686 1 8 27 BBa_B0015 1 BBa_B0015 double terminator (B0010-B0012) 2003-07-16T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator consisting of BBa_B0010 and BBa_B0012 false true _1_ 0 24 7 In stock false true Reshma Shetty component1916612 1 BBa_B0012 component1916610 1 BBa_B0010 annotation1916610 1 BBa_B0010 range1916610 1 1 80 annotation1916612 1 BBa_B0012 range1916612 1 89 129 BBa_K1033910 1 fwYellow fwYellow, yellow chromoprotein 2013-09-16T11:00:00Z 2016-01-25T02:41:53Z Synthetic chromoprotein from DNA 2.0. This chromoprotein naturally exhibits strong color when expressed. false false _1340_ 4206 13997 9 In stock false This construct is synthetic. It was synthesized from a template where the consensus sequence for the "color dependancy" in order to obtain a chromoprotein with a unique yellow color. false Sabri Jamal annotation2371218 1 fwYellow range2371218 1 1 711 BBa_I746361 1 BBa_I746361 PO promoter from P2 phage 2007-09-10T11:00:00Z 2015-08-31T04:08:04Z The source of the DNA is the P2 phage genome. Released HQ 2013 This is the PO promoter taken from the P2 phage genome. It is an inducible promoter that is activated by a class of activators, including P2 ogr (I746350), PSP3 pag (I746351) and phiR73 delta (I746352). These different activators should cause different levels of activity of the PO promoter. false false _116_ 0 2122 9 In stock false no special considerations true Stefan Milde annotation1943784 1 PO range1943784 1 1 92 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_I746361_sequence 1 cgcgccccgcgattcgctaaggtgctgttgtgtcagtgataagccatccgggactgatggcggaggatgcgcatcgtcgggaaactgatgcc BBa_K554002_sequence 1 ttagcctatggaagtcagggtgatcttaatccattaattaatgaaatcagcaaaatcatttcagcagcaggtagcttcgatgttaaagaggaaagaaccgcagcttctttattgcagttgtccggtaatgccagtgatttttcatatggacggaactcaataaccctgaccacatcagcataataa BBa_K1565002_sequence 1 cgcgccccgcgattcgctaaggtgctgttgtgtcagtgataagccatccgggactgatggcggaggatgcgcatcgtcgggaaactgatgcctactagagttagcctatggaagtcagggtgatcttaatccattaattaatgaaatcagcaaaatcatttcagcagcaggtagcttcgatgttaaagaggaaagaaccgcagcttctttattgcagttgtccggtaatgccagtgatttttcatatggacggaactcaataaccctgaccacatcagcataataatactagatgacggcactgactgaaggcgcaaaactgttcgagaaagaaatcccatatatcactgagctggaaggtgacgttgaaggtatgaagtttatcatcaagggtgaaggtaccggtgacgcgagcgtcggtaaagtggatgctcagttcatttgtaccacgggcgacgttccggttccgtggagcacgctggtcaccacgctgacgtatggtgctcagtgctttgccaagtatccgcgccacattgcggatttcttcaaaagctgcatgccggaaggttacgtccaagagcgcaccatcacctttgagggtgatggcgtgttcaagacccgtgcggaagtcacctttgaaaatggcagcgtgtacaaccgtgtaaaactgaacggccagggtttcaagaaggacggccacgtgctgggcaaaaatctggagtttaactttacccctcattgtttgtacatttggggtgaccaagcgaatcatggcctgaagagcgcgttcaaaatcatgcatgagatcaccggctccaaagaggatttcattgttgccgatcacacccaaatgaataccccgattggtggtggtccggtgcacgtgccggagtaccaccacattacgtatcatgttaccctgtctaaagacgtcaccgatcaccgtgaccatttgaacattgttgaggtgatcaaggcagttgacctggagacgtaccgttaataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_K1033910_sequence 1 atgacggcactgactgaaggcgcaaaactgttcgagaaagaaatcccatatatcactgagctggaaggtgacgttgaaggtatgaagtttatcatcaagggtgaaggtaccggtgacgcgagcgtcggtaaagtggatgctcagttcatttgtaccacgggcgacgttccggttccgtggagcacgctggtcaccacgctgacgtatggtgctcagtgctttgccaagtatccgcgccacattgcggatttcttcaaaagctgcatgccggaaggttacgtccaagagcgcaccatcacctttgagggtgatggcgtgttcaagacccgtgcggaagtcacctttgaaaatggcagcgtgtacaaccgtgtaaaactgaacggccagggtttcaagaaggacggccacgtgctgggcaaaaatctggagtttaactttacccctcattgtttgtacatttggggtgaccaagcgaatcatggcctgaagagcgcgttcaaaatcatgcatgagatcaccggctccaaagaggatttcattgttgccgatcacacccaaatgaataccccgattggtggtggtccggtgcacgtgccggagtaccaccacattacgtatcatgttaccctgtctaaagacgtcaccgatcaccgtgaccatttgaacattgttgaggtgatcaaggcagttgacctggagacgtaccgttaataa BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0015_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z