BBa_K157001 1 ErbB1 (SP) EGFR/ErbB1 signal peptide; mediates protein transport to a translocational pore 2008-10-23T11:00:00Z 2015-05-08T01:10:54Z Part derived from the sequence of EGFR/ErbB1 The N-terminal signal-peptide ensures protein transport to the cytoplasm-membrane. false false _232_ 0 1673 9 It's complicated false none false iGEM Team Freiburg 2008 annotation2041667 1 SP range2041667 1 1 72 annotation2041666 1 ErbB-1 Signal peptide range2041666 1 1 72 BBa_K157001_sequence 1 atgagaccatctggtactgctggagccgcattgctggcacttttggctgcgctgtgccctgcaagcagagca igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z