BBa_K157002 1 BBa_K157002 Transmembrane region of the EGF-Receptor (ErbB-1) 2008-10-25T11:00:00Z 2015-05-08T01:10:54Z Transmembrane region of the human EGF-Receptor type ErbB-1. Sequence taken from UniProtKB/Swiss-Prot entry P00533. Gene synthesis by ATG:biosynthetics, optimized for expression in homo sapiens by iGEM-Team Freiburg 2008. Helical, single-span transmembrane region of the human EGF-Receptor type ErbB-1, sequence taken from UniProtKB/Swiss-Prot entry P00533. false false _232_ 0 1673 9 It's complicated false Between BioBrick 1.0 sites this part is flanked 5' by NgoMI(=NgoMIV) and 3' AgeI(=PinAI) to facilitate in frame cloning for protein fusions. false iGEM Team Freiburg 2008 annotation2064675 1 EGFR-Transmembrane region range2064675 1 1 69 BBa_K157002_sequence 1 atagctaccggaatggtgggtgcacttttgctccttttggtcgttgccctggggataggactctttatg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z