BBa_K157010 1 BBa_K157010 glycine-serine linker fused to B-cell receptor transmembrane region; displays protein on cell surfac 2008-10-25T11:00:00Z 2015-05-08T01:10:54Z Gene synthesis by GeneArt, optimized for expression in homo sapiens. Helical single-span transmembrane region of the B-Cell-Receptor with a flexible 15 aa Linker at the N-terminus. Designed for fusion to proteins or peptides that are to be presented at the cells surface; signal peptide for membrane integration (e.g. part Bba_K157001) required at the N-terminus of the whole construct! false false _232_ 0 1673 9 It's complicated false Between BioBrick 1.0 sites this part is flanked 5' by NgoMI(=NgoMIV) and 3' AgeI(=PinAI) to facilitate in frame cloning for protein fusions. true iGEM Team Freiburg 2008 annotation2064765 1 GGGGSx3-BCR-Transmembrane range2064765 1 1 108 BBa_K157010_sequence 1 ggaggaggaggatctggcggcggaggaagcggtggcggcggaagcggcatcatcatgatccagaccctgctgatcatcctgttcatcatcgtgcccatctttctgctg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z