BBa_K157012 1 BBa_K157012 Strep affinity tag II; Freiburg standard 2008-10-25T11:00:00Z 2015-05-08T01:10:54Z Gene synthesis by ATG:biosynthetics, optimized for expression in homo sapiens by iGEM-Team Freiburg 2008. Strep tag as NgoMIV / AgeI protein fusion part, fusion to proteins facilitates detection, purification, immobilization. false false _232_ 0 1673 9 It's complicated false Between BioBrick 1.0 sites this part is flanked 5' by NgoMI(=NgoMIV) and 3' AgeI(=PinAI) to facilitate in frame cloning for protein fusions. true Kristian M??ller annotation2041865 1 Strep-Tag II range2041865 1 1 24 annotation2041866 1 Strep-Tag II range2041866 1 1 24 BBa_K157012_sequence 1 tggagccatccgcagtttgaaaaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z