BBa_K157013 1 linker 15 aa flexible glycine-serine protein domain linker; Freiburg standard 2008-10-25T11:00:00Z 2015-05-08T01:10:54Z Gene synthesis by ATG:biosynthetics, optimized for expression in homo sapiens by iGEM-Team Freiburg 2008 A flexible, 15 aa long linker designed for fusion to/of proteins or peptides via in frame cloning. Consists of Glycine and Serine only. false false _232_ 0 1673 9 It's complicated false Between BioBrick 1.0 sites this part is flanked 5' by NgoMI(=NgoMIV) and 3' AgeI(=PinAI) to facilitate in frame cloning for protein fusions. true Kristian M??ller annotation2064780 1 GGGGSx3-Linker range2064780 1 1 45 BBa_K157013_sequence 1 ggtggaggaggttctggaggcggtggaagtggtggcggaggtagc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z