BBa_K1583000 1 BBa_K1583000 CsgA 2015-09-01T11:00:00Z 2015-09-02T09:46:13Z The DNA was synthesized. The sequence originates from the genomic DNA of E. coli K-12 MG1655 (http://www.ncbi.nlm.nih.gov/gene/949055). This gene encodes for the protein CsgA. CsgA is a curlin subunit that can self-assemble into curli after nucleation on CsgB. They are produced in an unpolymerized form and secreted from the cell. CsgA is naturally produced by e.g. E. coli K-12 MG1655 from the operon CsgBA. A second operon, CsgDEFG encodes four additional proteins that are required for the curli assembly and secretion. false false _2000_ 24478 24478 9 false The nucleotides encoding for the third and fourth amino acids of the gene are changed to improve the success change of synthesis false Max van 't Hof annotation2442926 1 CsgA range2442926 1 1 456 BBa_K1583000_sequence 1 atgaaactgctgaaagtagcagcaattgcagcaatcgtattctccggtagcgctctggcaggtgttgttcctcagtacggcggcggcggtaaccacggtggtggcggtaataatagcggcccaaattctgagctgaacatttaccagtacggtggcggtaactctgcacttgctctgcaaactgatgcccgtaactctgacttgactattacccagcatggcggcggtaatggtgcagatgttggtcagggctcagatgacagctcaatcgatctgacccaacgtggcttcggtaacagcgctactcttgatcagtggaacggcaaaaattctgaaatgacggttaaacagttcggtggtggcaacggtgcagcagttgaccagactgcatctaactcctccgtcaacgtgactcaggttggctttggtaacaacgcgaccgctcatcagtactaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z