BBa_K1583001 1 BBa_K1583001 CsgC 2015-09-03T11:00:00Z 2015-09-18T06:36:25Z The RBS and CsgC were synthesized from the genomic sequence of E.coli K-12 MG1655. The promoter is part of the constitutive promoter family made by John Anderson from iGEM Berkeley 2006. CsgC is positively involved in the extracellular aggregation of CsgA into amyloid nanowires (curli assembly) in E.coli functioning as a chaperone for CsgA. false false _2000_ 24478 24463 9 false We inserted non-coding scar sequences after the promoter and RBS to prevent missing initial codons during transcription/translation. false Stefan Robert Marsden annotation2474746 1 CsgC range2474746 1 1 333 BBa_K1583001_sequence 1 atgaatacgttattactccttgcggcactttccagtcagataacctttaatacgacccagcaaggggatgtgtataccattattcctgaagtcactcttactcaatcttgtctgtgcagagtacaaatattgtccctgcgcgaaggcagttcagggcaaagtcagacgaagcaagaaaagaccctttcattgcctgctaatcaacccattgctttgacgaagttgagtttaaatatttccccggacgatcgggtgaaaatagttgttactgtttctgatggacagtcacttcatttatcacaacaatggccgccctcttcagaaaagtcttaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z