BBa_K1583003 1 BBa_K1583003 CsgA_His 2015-09-03T11:00:00Z 2015-09-04T04:16:37Z The DNA was synthesized. The sequence of CsgA originates from the genomic DNA of E. coli K-12 MG1655 (http://www.ncbi.nlm.nih.gov/gene/949055). The design was based on the paper "Programmable biofilm-based materials from engineered curli nanofibres"[1] 1. Nguyen, P. Q., Botyanszki, Z., Tay, P. K. R., & Joshi, N. S. (2014). Programmable biofilm-based materials from engineered curli nanofibres. Nature communications, 5. This gene encodes for the protein CsgA with a HIS-tag attached to it. CsgA is a curlin subunit that can self-assemble into curli after nucleation on CsgB. They are produced in an unpolymerized form and secreted from the cell. CsgA is naturally produced by e.g. E. coli K-12 MG1655 from the operon CsgBA. A second operon, CsgDEFG encodes four additional proteins that are required for the curli assembly and secretion. false false _2000_ 24478 24478 9 false The nucleotides encoding for the third and fourth amino acids of the gene are changed to improve the success change of synthesis false Max van 't Hof annotation2443427 1 Linker range2443427 1 453 471 annotation2443426 1 CsgA range2443426 1 1 452 annotation2443428 1 HIS-tag range2443428 1 472 492 BBa_K1583003_sequence 1 atgaaactgctgaaagtagcagcaattgcagcaatcgtattctccggtagcgctctggcaggtgttgttcctcagtacggcggcggcggtaaccacggtggtggcggtaataatagcggcccaaattctgagctgaacatttaccagtacggtggcggtaactctgcacttgctctgcaaactgatgcccgtaactctgacttgactattacccagcatggcggcggtaatggtgcagatgttggtcagggctcagatgacagctcaatcgatctgacccaacgtggcttcggtaacagcgctactcttgatcagtggaacggcaaaaattctgaaatgacggttaaacagttcggtggtggcaacggtgcagcagttgaccagactgcatctaactcctccgtcaacgtgactcaggttggctttggtaacaacgcgaccgctcatcagtacggcagcggtggcagtggccatcaccaccatcaccactaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z