BBa_K1583012 1 BBa_K1583012 Linker in fusion protein 2015-09-03T11:00:00Z 2015-09-18T06:53:59Z This DNA was synthesized. The design was based on the paper "Strong underwater adhesives made by self-assembling multi-protein nanofibres".[1] 1. C.Zhong, T.Gurry, A.Cheng, J.Downey, Z.Deng, C. Stultz, T.Lu, Nature Nanotechnology, 2014, 9, 858-866. This amino acid sequence was used as a linker to create a fusion protein from Mfp3/Mfp5 with CsgA. false false _2000_ 24478 24463 9 false No special design considerations needed to be taken. false Stefan Robert Marsden annotation2474770 1 Linker range2474770 1 1 30 BBa_K1583012_sequence 1 ggcggtggcggtagcggtggcggtggcagt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z