BBa_K1583013 1 BBa_K1583013 CsgA missing the start codon for fusion protein 2015-09-03T11:00:00Z 2015-09-18T06:57:49Z This DNA was synthesized. The design was based on the paper "Strong underwater adhesives made by self-assembling multi-protein nanofibres".[1] 1. C.Zhong, T.Gurry, A.Cheng, J.Downey, Z.Deng, C. Stultz, T.Lu, Nature Nanotechnology, 2014, 9, 858-866. An illegal PstI restriction site (766) in CsgA had to be mutated (A->G) not changing the protein sequence. In order to create a fusion protein of CsgA with Mfp5 in front of it, CsgA was designed without its start codon. false false _2000_ 24478 24463 9 false An illegal PstI restriction site (766) in CsgA had to be mutated (A->G) not changing the protein sequence. false Stefan Robert Marsden annotation2474838 1 CsgA range2474838 1 1 393 BBa_K1583013_sequence 1 ggtgttgttcctcagtacggcggcggcggtaaccacggtggtggcggtaataatagcggcccaaattctgagctgaacatttaccagtacggtggcggtaactctgcacttgctctgcaaactgatgcccgtaactctgacttgactattacccagcatggcggcggtaatggtgcagatgttggtcagggctcagatgacagctcaatcgatctgacccaacgtggcttcggtaacagcgctactcttgatcagtggaacggcaaaaattctgaaatgacggttaaacagttcggtggtggcaacggtgctgcggttgaccagactgcatctaactcctccgtcaacgtgactcaggttggctttggtaacaacgcgaccgctcatcagtac igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z