BBa_K1583014 1 BBa_K1583014 CsgA missing the stop codon for creation of fusion proteins 2015-09-03T11:00:00Z 2015-09-18T07:00:29Z The DNA was synthesized. The sequence originates from the genomic DNA of E. coli K-12 MG1655 (http://www.ncbi.nlm.nih.gov/gene/949055). This part was designed to create a fusion protein of CsgA with Mfp3 (mussel foot protein). This protein has got high adhesive properties towards wet polar surfaces. Like this, an amyloid nanowire with high binding properties is created. false false _2000_ 24478 24463 9 false The stop codon was deleted to create a fusion protein. false Stefan Robert Marsden annotation2474839 1 CsgA range2474839 1 1 453 BBa_K1583014_sequence 1 atgaaactgctgaaagtagcagcaattgcagcaatcgtattctccggtagcgctctggcaggtgttgttcctcagtacggcggcggcggtaaccacggtggtggcggtaataatagcggcccaaattctgagctgaacatttaccagtacggtggcggtaactctgcacttgctctgcaaactgatgcccgtaactctgacttgactattacccagcatggcggcggtaatggtgcagatgttggtcagggctcagatgacagctcaatcgatctgacccaacgtggcttcggtaacagcgctactcttgatcagtggaacggcaaaaattctgaaatgacggttaaacagttcggtggtggcaacggtgctgcggttgaccagactgcatctaactcctccgtcaacgtgactcaggttggctttggtaacaacgcgaccgctcatcagtac igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z