BBa_K1583056 1 BBa_K1583056 Spacer in between promoter and coding sequence 2015-09-03T11:00:00Z 2015-09-04T06:32:19Z This DNA was synthesized. The design was based on the paper "Strong underwater adhesives made by self-assembling multi-protein nanofibres".[1] 1. C.Zhong, T.Gurry, A.Cheng, J.Downey, Z.Deng, C. Stultz, T.Lu, Nature Nanotechnology, 2014, 9, 858-866. This sequence was designed as a spacer to prevent errors in transcription by placing the RBS too close to the promoter. false false _2000_ 24463 24463 9 false This sequence was designed as a spacer to prevent errors in transcription by placing the RBS too close to the promoter. Formation of a hairpin structure or self complementary sequences was avoided. false Stefan Robert Marsden annotation2475156 1 Spacer range2475156 1 1 27 BBa_K1583056_sequence 1 atactagagcagcaaggaaatactaga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z