BBa_K1583063 1 BBa_K1583063 Scar in CsgA_Mfp3 2015-09-07T11:00:00Z 2015-09-18T08:02:08Z The DNA was synthesized. The sequence originates from the genomic DNA of E. coli K-12 MG1655 (http://www.ncbi.nlm.nih.gov/gene/949055). This scar is part of a synthesized construct. It is used in BBa_K1583007. false false _2000_ 24478 24463 9 false No special design considerations. false Stefan Robert Marsden annotation2475163 1 Scar range2475163 1 1 27 BBa_K1583063_sequence 1 atactagagcagcaggtacctactaga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z