BBa_K1583050 1 BBa_K1583050 Scar 1 2015-09-03T11:00:00Z 2015-09-18T07:33:29Z This scar is part of a synthesized construct. Scar in constructs BBa_K1583100 - BBa_K1583112 false false _2000_ 24478 24478 9 false This scar originates from the part BBa_K1316015, on which the composite part BBa_K1583100 is based. false Max van 't Hof annotation2475064 1 Scar range2475064 1 1 25 BBa_G0002 1 SX scar SpeI/XbaI mixed site 2007-02-26T12:00:00Z 2015-08-31T04:07:27Z XbaI and SpeI sites XbaI/SpeI mixed site. Simply used to aid in entry of parts into the registry. false true _41_ 0 126 70 Not in stock false None. false Reshma Shetty BBa_K1583051 1 BBa_K1583051 Scar 2 2015-09-03T11:00:00Z 2015-09-18T07:34:25Z This scar is part of a synthesized construct. Scar in constructs BBa_K1583100 - BBa_K1583112 false false _2000_ 24478 24478 9 false This scar originates from the part BBa_K1316015, on which the composite part BBa_K1583100 is based. false Max van 't Hof annotation2475065 1 Scar range2475065 1 1 14 BBa_K1583100 1 BBa_K1583100 pRha + CsgA 2015-09-02T11:00:00Z 2015-09-18T11:09:29Z This part was synthesized. The rhamnose promoter was used by the iGEM 2014 TU Delft teama and originally added by the iGEM12 Paris Bettencourt team. RBS and CsgA originate from E. coli K-12 MG1655 CsgA under control of L-rhamnose-inducible promoter false false _2000_ 24478 24478 9 false The nucleotides encoding for the second and third amino acid of the CsgA gene were changed to optimize synthesis success. (silent mutations) false Max van 't Hof component2443486 1 BBa_K1583050 component2443490 1 BBa_K1583051 component2443483 1 BBa_G0002 component2443487 1 BBa_K1583008 component2443489 1 BBa_K1583000 component2443485 1 BBa_K914003 annotation2443490 1 BBa_K1583051 range2443490 1 625 638 annotation2443487 1 BBa_K1583008 range2443487 1 156 167 annotation2443486 1 BBa_K1583050 range2443486 1 131 155 annotation2443485 1 BBa_K914003 range2443485 1 9 130 annotation2443483 1 BBa_G0002 range2443483 1 1 8 annotation2443489 1 BBa_K1583000 range2443489 1 169 624 BBa_K1583000 1 BBa_K1583000 CsgA 2015-09-01T11:00:00Z 2015-09-02T09:46:13Z The DNA was synthesized. The sequence originates from the genomic DNA of E. coli K-12 MG1655 (http://www.ncbi.nlm.nih.gov/gene/949055). This gene encodes for the protein CsgA. CsgA is a curlin subunit that can self-assemble into curli after nucleation on CsgB. They are produced in an unpolymerized form and secreted from the cell. CsgA is naturally produced by e.g. E. coli K-12 MG1655 from the operon CsgBA. A second operon, CsgDEFG encodes four additional proteins that are required for the curli assembly and secretion. false false _2000_ 24478 24478 9 false The nucleotides encoding for the third and fourth amino acids of the gene are changed to improve the success change of synthesis false Max van 't Hof annotation2442926 1 CsgA range2442926 1 1 456 BBa_K914003 1 BBa_K914003 L-rhamnose-inducible promoter (pRha) 2012-09-19T11:00:00Z 2015-05-08T01:13:45Z Amplification of the plasmid pJOE3075 (Dr. Altenbuchner). Released HQ 2013 L-rhamnose-inducible promoter is capable of high-level recombinant protein expression in the presence of L-rhamnose, it is also tightly regulated in the absence of L-rhamnose by the addition of D-glucose. false false _1179_ 0 13487 9 In stock true One base pair modified (90: A -> T) to avoid EcoRI site. Mutation made in a less conserved base pair. false Denis Samuylov annotation2188559 1 pRha range2188559 1 1 122 BBa_K1583008 1 BBa_K1583008 RBS 2015-09-03T11:00:00Z 2015-09-04T05:18:43Z Synthesized RBS false false _2000_ 24478 24478 9 false Based on RBS of BBa_K1316015. false Max van BBa_K1583051_sequence 1 ctactagaaggagg BBa_K1583000_sequence 1 atgaaactgctgaaagtagcagcaattgcagcaatcgtattctccggtagcgctctggcaggtgttgttcctcagtacggcggcggcggtaaccacggtggtggcggtaataatagcggcccaaattctgagctgaacatttaccagtacggtggcggtaactctgcacttgctctgcaaactgatgcccgtaactctgacttgactattacccagcatggcggcggtaatggtgcagatgttggtcagggctcagatgacagctcaatcgatctgacccaacgtggcttcggtaacagcgctactcttgatcagtggaacggcaaaaattctgaaatgacggttaaacagttcggtggtggcaacggtgcagcagttgaccagactgcatctaactcctccgtcaacgtgactcaggttggctttggtaacaacgcgaccgctcatcagtactaa BBa_K1583100_sequence 1 tactagagccacaattcagcaaattgtgaacatcatcacgttcatctttccctggttgccaatggcccattttcctgtcagtaacgagaaggtcgcgtattcaggcgctttttagactggtcgtaatgaatactagagcagcaaggaaatactagaaggaggtatataatgaaactgctgaaagtagcagcaattgcagcaatcgtattctccggtagcgctctggcaggtgttgttcctcagtacggcggcggcggtaaccacggtggtggcggtaataatagcggcccaaattctgagctgaacatttaccagtacggtggcggtaactctgcacttgctctgcaaactgatgcccgtaactctgacttgactattacccagcatggcggcggtaatggtgcagatgttggtcagggctcagatgacagctcaatcgatctgacccaacgtggcttcggtaacagcgctactcttgatcagtggaacggcaaaaattctgaaatgacggttaaacagttcggtggtggcaacggtgcagcagttgaccagactgcatctaactcctccgtcaacgtgactcaggttggctttggtaacaacgcgaccgctcatcagtactaactactagaaggagg BBa_K1583050_sequence 1 tactagagcagcaaggaaatactag BBa_K1583008_sequence 1 aaggaggtatat BBa_G0002_sequence 1 tactagag BBa_K914003_sequence 1 ccacaattcagcaaattgtgaacatcatcacgttcatctttccctggttgccaatggcccattttcctgtcagtaacgagaaggtcgcgtattcaggcgctttttagactggtcgtaatgaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z