BBa_G0002 1 SX scar SpeI/XbaI mixed site 2007-02-26T12:00:00Z 2015-08-31T04:07:27Z XbaI and SpeI sites XbaI/SpeI mixed site. Simply used to aid in entry of parts into the registry. false true _41_ 0 126 70 Not in stock false None. false Reshma Shetty BBa_K914003 1 BBa_K914003 L-rhamnose-inducible promoter (pRha) 2012-09-19T11:00:00Z 2015-05-08T01:13:45Z Amplification of the plasmid pJOE3075 (Dr. Altenbuchner). Released HQ 2013 L-rhamnose-inducible promoter is capable of high-level recombinant protein expression in the presence of L-rhamnose, it is also tightly regulated in the absence of L-rhamnose by the addition of D-glucose. false false _1179_ 0 13487 9 In stock true One base pair modified (90: A -> T) to avoid EcoRI site. Mutation made in a less conserved base pair. false Denis Samuylov annotation2188559 1 pRha range2188559 1 1 122 BBa_K1583003 1 BBa_K1583003 CsgA_His 2015-09-03T11:00:00Z 2015-09-04T04:16:37Z The DNA was synthesized. The sequence of CsgA originates from the genomic DNA of E. coli K-12 MG1655 (http://www.ncbi.nlm.nih.gov/gene/949055). The design was based on the paper "Programmable biofilm-based materials from engineered curli nanofibres"[1] 1. Nguyen, P. Q., Botyanszki, Z., Tay, P. K. R., & Joshi, N. S. (2014). Programmable biofilm-based materials from engineered curli nanofibres. Nature communications, 5. This gene encodes for the protein CsgA with a HIS-tag attached to it. CsgA is a curlin subunit that can self-assemble into curli after nucleation on CsgB. They are produced in an unpolymerized form and secreted from the cell. CsgA is naturally produced by e.g. E. coli K-12 MG1655 from the operon CsgBA. A second operon, CsgDEFG encodes four additional proteins that are required for the curli assembly and secretion. false false _2000_ 24478 24478 9 false The nucleotides encoding for the third and fourth amino acids of the gene are changed to improve the success change of synthesis false Max van 't Hof annotation2443427 1 Linker range2443427 1 453 471 annotation2443428 1 HIS-tag range2443428 1 472 492 annotation2443426 1 CsgA range2443426 1 1 452 BBa_K1583050 1 BBa_K1583050 Scar 1 2015-09-03T11:00:00Z 2015-09-18T07:33:29Z This scar is part of a synthesized construct. Scar in constructs BBa_K1583100 - BBa_K1583112 false false _2000_ 24478 24478 9 false This scar originates from the part BBa_K1316015, on which the composite part BBa_K1583100 is based. false Max van 't Hof annotation2475064 1 Scar range2475064 1 1 25 BBa_K1583008 1 BBa_K1583008 RBS 2015-09-03T11:00:00Z 2015-09-04T05:18:43Z Synthesized RBS false false _2000_ 24478 24478 9 false Based on RBS of BBa_K1316015. false Max van BBa_K1583101 1 BBa_K1583101 pRha + CsgA + His-tag 2015-09-03T11:00:00Z 2016-01-25T11:29:45Z The DNA was synthesized. The sequence of CsgA originates from the genomic DNA of E. coli K-12 MG1655 (http://www.ncbi.nlm.nih.gov/gene/949055). The design was based on the paper ""Programmable biofilm-based materials from engineered curli nanofibres""[1] 1. Nguyen, P. Q., Botyanszki, Z., Tay, P. K. R., & Joshi, N. S. (2014). Programmable biofilm-based materials from engineered curli nanofibres. Nature communications, 5. CsgA with HIS-tag attachted to the C-terminus under control of L-rhamnose-inducible promoter false false _2000_ 4206 24478 9 false The nucleotides encoding for the second and third amino acid of the CsgA gene were changed to optimize synthesis success. (silent mutations) false Hector Sanguesa Ferrer, Max van component2443477 1 BBa_K1583008 component2443473 1 BBa_G0002 component2443481 1 BBa_K1583003 component2443476 1 BBa_K1583050 component2443475 1 BBa_K914003 annotation2443473 1 BBa_G0002 range2443473 1 1 8 annotation2443477 1 BBa_K1583008 range2443477 1 156 167 annotation2443475 1 BBa_K914003 range2443475 1 9 130 annotation2443481 1 BBa_K1583003 range2443481 1 169 660 annotation2443476 1 BBa_K1583050 range2443476 1 131 155 BBa_K1583003_sequence 1 atgaaactgctgaaagtagcagcaattgcagcaatcgtattctccggtagcgctctggcaggtgttgttcctcagtacggcggcggcggtaaccacggtggtggcggtaataatagcggcccaaattctgagctgaacatttaccagtacggtggcggtaactctgcacttgctctgcaaactgatgcccgtaactctgacttgactattacccagcatggcggcggtaatggtgcagatgttggtcagggctcagatgacagctcaatcgatctgacccaacgtggcttcggtaacagcgctactcttgatcagtggaacggcaaaaattctgaaatgacggttaaacagttcggtggtggcaacggtgcagcagttgaccagactgcatctaactcctccgtcaacgtgactcaggttggctttggtaacaacgcgaccgctcatcagtacggcagcggtggcagtggccatcaccaccatcaccactaa BBa_K1583101_sequence 1 tactagagccacaattcagcaaattgtgaacatcatcacgttcatctttccctggttgccaatggcccattttcctgtcagtaacgagaaggtcgcgtattcaggcgctttttagactggtcgtaatgaatactagagcagcaaggaaatactagaaggaggtatataatgaaactgctgaaagtagcagcaattgcagcaatcgtattctccggtagcgctctggcaggtgttgttcctcagtacggcggcggcggtaaccacggtggtggcggtaataatagcggcccaaattctgagctgaacatttaccagtacggtggcggtaactctgcacttgctctgcaaactgatgcccgtaactctgacttgactattacccagcatggcggcggtaatggtgcagatgttggtcagggctcagatgacagctcaatcgatctgacccaacgtggcttcggtaacagcgctactcttgatcagtggaacggcaaaaattctgaaatgacggttaaacagttcggtggtggcaacggtgcagcagttgaccagactgcatctaactcctccgtcaacgtgactcaggttggctttggtaacaacgcgaccgctcatcagtacggcagcggtggcagtggccatcaccaccatcaccactaa BBa_K1583050_sequence 1 tactagagcagcaaggaaatactag BBa_K1583008_sequence 1 aaggaggtatat BBa_G0002_sequence 1 tactagag BBa_K914003_sequence 1 ccacaattcagcaaattgtgaacatcatcacgttcatctttccctggttgccaatggcccattttcctgtcagtaacgagaaggtcgcgtattcaggcgctttttagactggtcgtaatgaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z