BBa_K1583104 1 BBa_K1583104 pRha + Mfp5_CsgA_His fusion protein 2015-09-03T11:00:00Z 2015-09-18T03:37:06Z This part originates from the E.coli K-12 MG1655 genome and from mussels. The design was based on the paper "Strong underwater adhesives made by self-assembling multi-protein nanofibres".[1] 1. C.Zhong, T.Gurry, A.Cheng, J.Downey, Z.Deng, C. Stultz, T.Lu, Nature Nanotechnology, 2014, 9, 858-866. CsgA is a protein monomer which can aggregate to form amyloid nanowires in natural biofilms taken from E.coli K-12 MG1655. Inspired by mussels, the Mfp5 (mussel foot protein) has high adhesive properties towards wet polar surfaces. By creating a fusion protein, the adhesive properties of the mussel foot protein is combined with the formation of nanowires. This DNA was synthesized. The design was based on the paper "Strong underwater adhesives made by self-assembling multi-protein nanofibres".[1] 1. C.Zhong, T.Gurry, A.Cheng, J.Downey, Z.Deng, C. Stultz, T.Lu, Nature Nanotechnology, 2014, 9, 858-866. The CsgA sequence originates from the genomic DNA of E. coli K-12 MG1655 (http://www.ncbi.nlm.nih.gov/gene/949055). false false _2000_ 24478 24463 9 false A mutation had to be introduced at base pair 766 to remove a PstI restriction site. The protein sequence was not changed in doing so. false Stefan Robert Marsden component2461127 1 BBa_K1583059 component2461121 1 BBa_K914003 component2461123 1 BBa_K1583061 component2461119 1 BBa_K1583054 component2461124 1 BBa_K1583002 component2461125 1 BBa_K1583012 component2461122 1 BBa_K1583056 component2461126 1 BBa_K1583013 component2461128 1 BBa_K1583057 annotation2461121 1 BBa_K914003 range2461121 1 9 130 annotation2461126 1 BBa_K1583013 range2461126 1 431 823 annotation2461128 1 BBa_K1583057 range2461128 1 845 850 annotation2461124 1 BBa_K1583002 range2461124 1 170 400 annotation2461119 1 BBa_K1583054 range2461119 1 1 6 annotation2461125 1 BBa_K1583012 range2461125 1 401 430 annotation2461122 1 BBa_K1583056 range2461122 1 131 157 annotation2461123 1 BBa_K1583061 range2461123 1 158 169 annotation2461127 1 BBa_K1583059 range2461127 1 824 844 BBa_K1583054 1 BBa_K1583054 Non-coding scar site in between RBS and gene 2015-09-03T11:00:00Z 2015-09-18T08:03:55Z The RBS and CsgC were synthesized from the genomic sequence of E.coli K-12 MG1655. The promoter is part of the constitutive promoter family made by John Anderson from iGEM Berkeley 2006. CsgC is positively involved in the extracellular aggregation of CsgA into amyloid nanowires (curli assembly) in E.coli functioning as a chaperone for CsgA. false false _2000_ 24478 24463 9 false We inserted non-coding scar sequences after the promoter and RBS to prevent missing initial codons during transcription/translation. false Stefan Robert Marsden annotation2475152 1 Scar range2475152 1 1 6 BBa_K1583013 1 BBa_K1583013 CsgA missing the start codon for fusion protein 2015-09-03T11:00:00Z 2015-09-18T06:57:49Z This DNA was synthesized. The design was based on the paper "Strong underwater adhesives made by self-assembling multi-protein nanofibres".[1] 1. C.Zhong, T.Gurry, A.Cheng, J.Downey, Z.Deng, C. Stultz, T.Lu, Nature Nanotechnology, 2014, 9, 858-866. An illegal PstI restriction site (766) in CsgA had to be mutated (A->G) not changing the protein sequence. In order to create a fusion protein of CsgA with Mfp5 in front of it, CsgA was designed without its start codon. false false _2000_ 24478 24463 9 false An illegal PstI restriction site (766) in CsgA had to be mutated (A->G) not changing the protein sequence. false Stefan Robert Marsden annotation2474838 1 CsgA range2474838 1 1 393 BBa_K1583002 1 BBa_K1583002 Mfp5 adhesive protein 2015-09-03T11:00:00Z 2015-09-18T06:35:39Z This DNA was synthesized. The design was based on the paper "Strong underwater adhesives made by self-assembling multi-protein nanofibres".[1] 1. C.Zhong, T.Gurry, A.Cheng, J.Downey, Z.Deng, C.Stultz, T. Lu, Nature Nanotechnology 2014, 9, 858-866. Inspired by mussels, the Mfp5 (mussel foot protein) has high adhesive properties towards wet polar surfaces. false false _2000_ 24478 24463 9 false No special considerations were required. false Stefan Robert Marsden annotation2474745 1 Mfp5 range2474745 1 1 231 BBa_K1583059 1 BBa_K1583059 His-tag without start codon 2015-09-03T11:00:00Z 2015-09-18T11:05:34Z Standard DNA sequence optimized for E.coli. Addition of a His tag at the N-terminal end of a protein of interest is goal of this basic part. false false _2000_ 24478 24463 9 false The codon was optimized for synthesis to avoid repetetive motives of too many codons. false Stefan Robert Marsden annotation2473195 1 His-tag range2473195 1 1 21 BBa_K914003 1 BBa_K914003 L-rhamnose-inducible promoter (pRha) 2012-09-19T11:00:00Z 2015-05-08T01:13:45Z Amplification of the plasmid pJOE3075 (Dr. Altenbuchner). Released HQ 2013 L-rhamnose-inducible promoter is capable of high-level recombinant protein expression in the presence of L-rhamnose, it is also tightly regulated in the absence of L-rhamnose by the addition of D-glucose. false false _1179_ 0 13487 9 In stock true One base pair modified (90: A -> T) to avoid EcoRI site. Mutation made in a less conserved base pair. false Denis Samuylov annotation2188559 1 pRha range2188559 1 1 122 BBa_K1583061 1 BBa_K1583061 RBS 2015-09-07T11:00:00Z 2015-09-08T07:43:48Z The DNA was synthesized. The sequence originates from the genomic DNA of E. coli K-12 MG1655 (http://www.ncbi.nlm.nih.gov/gene/949055). The design was based on the paper "Strong underwater adhesives made by self-assembling multi-protein nanofibres".[1] 1. C.Zhong, T.Gurry, A.Cheng, J.Downey, Z.Deng, C. Stultz, T.Lu, Nature Nanotechnology, 2014, 9, 858-866. This RBS was used in our constructs Mfp5+CsgA and CsgA+Mfp3. CsgA is a protein monomer which can aggregate to form amyloid nanowires in natural biofilms taken from E.coli K-12 MG1655. Inspired by mussels, the Mfp5 (mussel foot protein) has high adhesive properties towards wet polar surfaces. This DNA was synthesized. The design was based on the paper "Strong underwater adhesives made by self-assembling multi-protein nanofibres".[1] 1. C.Zhong, T.Gurry, A.Cheng, J.Downey, Z.Deng, C. Stultz, T.Lu, Nature Nanotechnology, 2014, 9, 858-866. false false _2000_ 24463 24463 9 false The design was based on the paper "Strong underwater adhesives made by self-assembling multi-protein nanofibres".[1] 1. C.Zhong, T.Gurry, A.Cheng, J.Downey, Z.Deng, C. Stultz, T.Lu, Nature Nanotechnology, 2014, 9, 858-866. false Stefan Robert Marsden annotation2475161 1 RBS range2475161 1 1 12 BBa_K1583056 1 BBa_K1583056 Spacer in between promoter and coding sequence 2015-09-03T11:00:00Z 2015-09-04T06:32:19Z This DNA was synthesized. The design was based on the paper "Strong underwater adhesives made by self-assembling multi-protein nanofibres".[1] 1. C.Zhong, T.Gurry, A.Cheng, J.Downey, Z.Deng, C. Stultz, T.Lu, Nature Nanotechnology, 2014, 9, 858-866. This sequence was designed as a spacer to prevent errors in transcription by placing the RBS too close to the promoter. false false _2000_ 24463 24463 9 false This sequence was designed as a spacer to prevent errors in transcription by placing the RBS too close to the promoter. Formation of a hairpin structure or self complementary sequences was avoided. false Stefan Robert Marsden annotation2475156 1 Spacer range2475156 1 1 27 BBa_K1583057 1 BBa_K1583057 Spacer in between coding sequence and suffix 2015-09-03T11:00:00Z 2015-09-04T06:40:05Z Non-coding and non-self-complementary codons were chosen at random. Designed as a spacer of 6 base pairs between our coding sequence and the biobrick suffix. false false _2000_ 24463 24463 9 false Hairpin formation and self-complementary sequences were avoided. false Stefan Robert Marsden annotation2475159 1 Scar range2475159 1 1 6 BBa_K1583012 1 BBa_K1583012 Linker in fusion protein 2015-09-03T11:00:00Z 2015-09-18T06:53:59Z This DNA was synthesized. The design was based on the paper "Strong underwater adhesives made by self-assembling multi-protein nanofibres".[1] 1. C.Zhong, T.Gurry, A.Cheng, J.Downey, Z.Deng, C. Stultz, T.Lu, Nature Nanotechnology, 2014, 9, 858-866. This amino acid sequence was used as a linker to create a fusion protein from Mfp3/Mfp5 with CsgA. false false _2000_ 24478 24463 9 false No special design considerations needed to be taken. false Stefan Robert Marsden annotation2474770 1 Linker range2474770 1 1 30 BBa_K1583104_sequence 1 tactagagccacaattcagcaaattgtgaacatcatcacgttcatctttccctggttgccaatggcccattttcctgtcagtaacgagaaggtcgcgtattcaggcgctttttagactggtcgtaatgaaatactagagcagcaaggaaatactagaaaagaggagaaaatgagttctgaagaatacaaaggtggttattacccaggcaatacttaccactatcattcaggtggtagttatcacggatccggctatcatggaggatataagggaaagtattacggaaaggcaaagaaatactattataaatataaaaacagcggaaaatacaagtatctgaagaaagctagaaaataccatagaaagggttacaagaagtattatggaggtggtagcagtggcggtggcggtagcggtggcggtggcagtggtgttgttcctcagtacggcggcggcggtaaccacggtggtggcggtaataatagcggcccaaattctgagctgaacatttaccagtacggtggcggtaactctgcacttgctctgcaaactgatgcccgtaactctgacttgactattacccagcatggcggcggtaatggtgcagatgttggtcagggctcagatgacagctcaatcgatctgacccaacgtggcttcggtaacagcgctactcttgatcagtggaacggcaaaaattctgaaatgacggttaaacagttcggtggtggcaacggtgctgcggttgaccagactgcatctaactcctccgtcaacgtgactcaggttggctttggtaacaacgcgaccgctcatcagtaccatcaccatcaccatcactaaggtacc BBa_K1583056_sequence 1 atactagagcagcaaggaaatactaga BBa_K1583057_sequence 1 ggtacc BBa_K1583059_sequence 1 catcaccatcaccatcactaa BBa_K1583061_sequence 1 aaagaggagaaa BBa_K1583054_sequence 1 tactag BBa_K914003_sequence 1 ccacaattcagcaaattgtgaacatcatcacgttcatctttccctggttgccaatggcccattttcctgtcagtaacgagaaggtcgcgtattcaggcgctttttagactggtcgtaatgaa BBa_K1583012_sequence 1 ggcggtggcggtagcggtggcggtggcagt BBa_K1583013_sequence 1 ggtgttgttcctcagtacggcggcggcggtaaccacggtggtggcggtaataatagcggcccaaattctgagctgaacatttaccagtacggtggcggtaactctgcacttgctctgcaaactgatgcccgtaactctgacttgactattacccagcatggcggcggtaatggtgcagatgttggtcagggctcagatgacagctcaatcgatctgacccaacgtggcttcggtaacagcgctactcttgatcagtggaacggcaaaaattctgaaatgacggttaaacagttcggtggtggcaacggtgctgcggttgaccagactgcatctaactcctccgtcaacgtgactcaggttggctttggtaacaacgcgaccgctcatcagtac BBa_K1583002_sequence 1 atgagttctgaagaatacaaaggtggttattacccaggcaatacttaccactatcattcaggtggtagttatcacggatccggctatcatggaggatataagggaaagtattacggaaaggcaaagaaatactattataaatataaaaacagcggaaaatacaagtatctgaagaaagctagaaaataccatagaaagggttacaagaagtattatggaggtggtagcagt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z