BBa_K914003 1 BBa_K914003 L-rhamnose-inducible promoter (pRha) 2012-09-19T11:00:00Z 2015-05-08T01:13:45Z Amplification of the plasmid pJOE3075 (Dr. Altenbuchner). Released HQ 2013 L-rhamnose-inducible promoter is capable of high-level recombinant protein expression in the presence of L-rhamnose, it is also tightly regulated in the absence of L-rhamnose by the addition of D-glucose. false false _1179_ 0 13487 9 In stock true One base pair modified (90: A -> T) to avoid EcoRI site. Mutation made in a less conserved base pair. false Denis Samuylov annotation2188559 1 pRha range2188559 1 1 122 BBa_E1010 1 mRFP1 **highly** engineered mutant of red fluorescent protein from Discosoma striata (coral) 2004-07-27T11:00:00Z 2015-08-31T04:07:26Z Campbell et al., PNAS v99 p7877 <a href="http://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pubmed&pubmedid=12060735">URL</a> Released HQ 2013 monomeric RFP: Red Fluorescent Protein. Excitation peak: 584 nm Emission peak: 607 nm false false _11_1_ 0 52 7 In stock false TAATAA double stop codon added (DE). Four silent mutations made to remove three EcoRI sites and one PstI site: A28G, A76G, A349G, G337A. true Drew Endy annotation2214014 1 Help:Barcodes range2214014 1 682 706 annotation1014044 1 mrfp1 range1014044 1 1 675 BBa_I13521 1 BBa_I13521 Ptet mRFP 2005-06-21T11:00:00Z 2015-08-31T04:07:34Z Released HQ 2013 Constitutive on mRFP (positive control) false true _11_ 0 253 6 In stock false true jkm component1532589 1 BBa_B0012 component1532566 1 BBa_B0034 component1532558 1 BBa_R0040 component1532573 1 BBa_E1010 component1532579 1 BBa_B0010 annotation1532579 1 BBa_B0010 range1532579 1 795 874 annotation1532573 1 BBa_E1010 range1532573 1 81 761 annotation1532566 1 BBa_B0034 range1532566 1 63 74 annotation1532589 1 BBa_B0012 range1532589 1 883 923 annotation1532558 1 BBa_R0040 range1532558 1 1 54 BBa_K1583012 1 BBa_K1583012 Linker in fusion protein 2015-09-03T11:00:00Z 2015-09-18T06:53:59Z This DNA was synthesized. The design was based on the paper "Strong underwater adhesives made by self-assembling multi-protein nanofibres".[1] 1. C.Zhong, T.Gurry, A.Cheng, J.Downey, Z.Deng, C. Stultz, T.Lu, Nature Nanotechnology, 2014, 9, 858-866. This amino acid sequence was used as a linker to create a fusion protein from Mfp3/Mfp5 with CsgA. false false _2000_ 24478 24463 9 false No special design considerations needed to be taken. false Stefan Robert Marsden annotation2474770 1 Linker range2474770 1 1 30 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1690 1 polya range1690 1 28 41 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 annotation1686 1 T7 TE range1686 1 8 27 BBa_R0040 1 p(tetR) TetR repressible promoter 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z Lutz, R., Bujard, H., <em>Nucleic Acids Research</em> (1997) 25, 1203-1210. Released HQ 2013 Sequence for pTet inverting regulator driven by the TetR protein.</P> false true _1_ 0 24 7 In stock false <P> <P>BBa_R0040 TetR-Regulated Promoter is based on a cI promoter. It has been modified to include two TetR binding sites and the BioBrick standard assembly head and tail restriction sites.<P> true June Rhee, Connie Tao, Ty Thomson, Louis Waldman annotation1986785 1 -35 range1986785 1 20 25 annotation1986784 1 BBa_R0040 range1986784 1 1 54 annotation1986783 1 TetR 1 range1986783 1 1 19 annotation1986787 1 -10 range1986787 1 43 48 annotation1986786 1 TetR 2 range1986786 1 26 44 BBa_K1583058 1 BBa_K1583058 RBS 2015-09-03T11:00:00Z 2015-09-04T06:58:12Z 1. C.Zhong, T.Gurry, A.Cheng, J.Downey, Z.Deng, C. Stultz, T.Lu, Nature Nanotechnology, 2014, 9, 858-866. This RBS was used in the article "Strong underwater adhesives made by self-assembling multi-protein nanofibres". 1. C.Zhong, T.Gurry, A.Cheng, J.Downey, Z.Deng, C. Stultz, T.Lu, Nature Nanotechnology, 2014, 9, 858-866. false false _2000_ 24463 24463 9 false No special design considerations were made. false Stefan Robert Marsden annotation2475160 1 RBS range2475160 1 1 12 BBa_K1583059 1 BBa_K1583059 His-tag without start codon 2015-09-03T11:00:00Z 2015-09-18T11:05:34Z Standard DNA sequence optimized for E.coli. Addition of a His tag at the N-terminal end of a protein of interest is goal of this basic part. false false _2000_ 24478 24463 9 false The codon was optimized for synthesis to avoid repetetive motives of too many codons. false Stefan Robert Marsden annotation2473195 1 His-tag range2473195 1 1 21 BBa_K1583110 1 BBa_K1583110 pRha + Mfp5_CsgA_His fusion protein & pTET + RFP 2015-09-03T11:00:00Z 2015-09-18T03:36:29Z The DNA was synthesized. The sequence originates from the genomic DNA of E. coli K-12 MG1655 (http://www.ncbi.nlm.nih.gov/gene/949055). The fusion protein of Mfp5 with CsgA and N-terminal His tag was improved by insertion of constitutively expressed RFP in a different operon to make the cells red fluorescent. false false _2000_ 24478 24463 9 false The RFP operon was placed in front of the coding operon to take advantage of its double terminators. false Stefan Robert Marsden component2443602 1 BBa_K1583058 component2443603 1 BBa_K1583002 component2443605 1 BBa_K1583013 component2443606 1 BBa_K1583059 component2443599 1 BBa_K914003 component2443601 1 BBa_K1583056 component2443598 1 BBa_I13521 component2443604 1 BBa_K1583012 annotation2443598 1 BBa_I13521 range2443598 1 1 923 annotation2443601 1 BBa_K1583056 range2443601 1 1054 1080 annotation2443602 1 BBa_K1583058 range2443602 1 1081 1092 annotation2443599 1 BBa_K914003 range2443599 1 932 1053 annotation2443604 1 BBa_K1583012 range2443604 1 1324 1353 annotation2443606 1 BBa_K1583059 range2443606 1 1747 1767 annotation2443605 1 BBa_K1583013 range2443605 1 1354 1746 annotation2443603 1 BBa_K1583002 range2443603 1 1093 1323 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_K1583013 1 BBa_K1583013 CsgA missing the start codon for fusion protein 2015-09-03T11:00:00Z 2015-09-18T06:57:49Z This DNA was synthesized. The design was based on the paper "Strong underwater adhesives made by self-assembling multi-protein nanofibres".[1] 1. C.Zhong, T.Gurry, A.Cheng, J.Downey, Z.Deng, C. Stultz, T.Lu, Nature Nanotechnology, 2014, 9, 858-866. An illegal PstI restriction site (766) in CsgA had to be mutated (A->G) not changing the protein sequence. In order to create a fusion protein of CsgA with Mfp5 in front of it, CsgA was designed without its start codon. false false _2000_ 24478 24463 9 false An illegal PstI restriction site (766) in CsgA had to be mutated (A->G) not changing the protein sequence. false Stefan Robert Marsden annotation2474838 1 CsgA range2474838 1 1 393 BBa_K1583002 1 BBa_K1583002 Mfp5 adhesive protein 2015-09-03T11:00:00Z 2015-09-18T06:35:39Z This DNA was synthesized. The design was based on the paper "Strong underwater adhesives made by self-assembling multi-protein nanofibres".[1] 1. C.Zhong, T.Gurry, A.Cheng, J.Downey, Z.Deng, C.Stultz, T. Lu, Nature Nanotechnology 2014, 9, 858-866. Inspired by mussels, the Mfp5 (mussel foot protein) has high adhesive properties towards wet polar surfaces. false false _2000_ 24478 24463 9 false No special considerations were required. false Stefan Robert Marsden annotation2474745 1 Mfp5 range2474745 1 1 231 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_K1583056 1 BBa_K1583056 Spacer in between promoter and coding sequence 2015-09-03T11:00:00Z 2015-09-04T06:32:19Z This DNA was synthesized. The design was based on the paper "Strong underwater adhesives made by self-assembling multi-protein nanofibres".[1] 1. C.Zhong, T.Gurry, A.Cheng, J.Downey, Z.Deng, C. Stultz, T.Lu, Nature Nanotechnology, 2014, 9, 858-866. This sequence was designed as a spacer to prevent errors in transcription by placing the RBS too close to the promoter. false false _2000_ 24463 24463 9 false This sequence was designed as a spacer to prevent errors in transcription by placing the RBS too close to the promoter. Formation of a hairpin structure or self complementary sequences was avoided. false Stefan Robert Marsden annotation2475156 1 Spacer range2475156 1 1 27 BBa_I13521_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcactactagagaaagaggagaaatactagatggcttcctccgaagacgttatcaaagagttcatgcgtttcaaagttcgtatggaaggttccgttaacggtcacgagttcgaaatcgaaggtgaaggtgaaggtcgtccgtacgaaggtacccagaccgctaaactgaaagttaccaaaggtggtccgctgccgttcgcttgggacatcctgtccccgcagttccagtacggttccaaagcttacgttaaacacccggctgacatcccggactacctgaaactgtccttcccggaaggtttcaaatgggaacgtgttatgaacttcgaagacggtggtgttgttaccgttacccaggactcctccctgcaagacggtgagttcatctacaaagttaaactgcgtggtaccaacttcccgtccgacggtccggttatgcagaaaaaaaccatgggttgggaagcttccaccgaacgtatgtacccggaagacggtgctctgaaaggtgaaatcaaaatgcgtctgaaactgaaagacggtggtcactacgacgctgaagttaaaaccacctacatggctaaaaaaccggttcagctgccgggtgcttacaaaaccgacatcaaactggacatcacctcccacaacgaagactacaccatcgttgaacagtacgaacgtgctgaaggtcgtcactccaccggtgcttaataacgctgatagtgctagtgtagatcgctactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_K1583110_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcactactagagaaagaggagaaatactagatggcttcctccgaagacgttatcaaagagttcatgcgtttcaaagttcgtatggaaggttccgttaacggtcacgagttcgaaatcgaaggtgaaggtgaaggtcgtccgtacgaaggtacccagaccgctaaactgaaagttaccaaaggtggtccgctgccgttcgcttgggacatcctgtccccgcagttccagtacggttccaaagcttacgttaaacacccggctgacatcccggactacctgaaactgtccttcccggaaggtttcaaatgggaacgtgttatgaacttcgaagacggtggtgttgttaccgttacccaggactcctccctgcaagacggtgagttcatctacaaagttaaactgcgtggtaccaacttcccgtccgacggtccggttatgcagaaaaaaaccatgggttgggaagcttccaccgaacgtatgtacccggaagacggtgctctgaaaggtgaaatcaaaatgcgtctgaaactgaaagacggtggtcactacgacgctgaagttaaaaccacctacatggctaaaaaaccggttcagctgccgggtgcttacaaaaccgacatcaaactggacatcacctcccacaacgaagactacaccatcgttgaacagtacgaacgtgctgaaggtcgtcactccaccggtgcttaataacgctgatagtgctagtgtagatcgctactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttatatactagagccacaattcagcaaattgtgaacatcatcacgttcatctttccctggttgccaatggcccattttcctgtcagtaacgagaaggtcgcgtattcaggcgctttttagactggtcgtaatgaaatactagagcagcaaggaaatactagaaggaggtatataatgagttctgaagaatacaaaggtggttattacccaggcaatacttaccactatcattcaggtggtagttatcacggatccggctatcatggaggatataagggaaagtattacggaaaggcaaagaaatactattataaatataaaaacagcggaaaatacaagtatctgaagaaagctagaaaataccatagaaagggttacaagaagtattatggaggtggtagcagtggcggtggcggtagcggtggcggtggcagtggtgttgttcctcagtacggcggcggcggtaaccacggtggtggcggtaataatagcggcccaaattctgagctgaacatttaccagtacggtggcggtaactctgcacttgctctgcaaactgatgcccgtaactctgacttgactattacccagcatggcggcggtaatggtgcagatgttggtcagggctcagatgacagctcaatcgatctgacccaacgtggcttcggtaacagcgctactcttgatcagtggaacggcaaaaattctgaaatgacggttaaacagttcggtggtggcaacggtgctgcggttgaccagactgcatctaactcctccgtcaacgtgactcaggttggctttggtaacaacgcgaccgctcatcagtaccatcaccatcaccatcactaa BBa_B0034_sequence 1 aaagaggagaaa BBa_K1583059_sequence 1 catcaccatcaccatcactaa BBa_E1010_sequence 1 atggcttcctccgaagacgttatcaaagagttcatgcgtttcaaagttcgtatggaaggttccgttaacggtcacgagttcgaaatcgaaggtgaaggtgaaggtcgtccgtacgaaggtacccagaccgctaaactgaaagttaccaaaggtggtccgctgccgttcgcttgggacatcctgtccccgcagttccagtacggttccaaagcttacgttaaacacccggctgacatcccggactacctgaaactgtccttcccggaaggtttcaaatgggaacgtgttatgaacttcgaagacggtggtgttgttaccgttacccaggactcctccctgcaagacggtgagttcatctacaaagttaaactgcgtggtaccaacttcccgtccgacggtccggttatgcagaaaaaaaccatgggttgggaagcttccaccgaacgtatgtacccggaagacggtgctctgaaaggtgaaatcaaaatgcgtctgaaactgaaagacggtggtcactacgacgctgaagttaaaaccacctacatggctaaaaaaccggttcagctgccgggtgcttacaaaaccgacatcaaactggacatcacctcccacaacgaagactacaccatcgttgaacagtacgaacgtgctgaaggtcgtcactccaccggtgcttaataacgctgatagtgctagtgtagatcgc BBa_K914003_sequence 1 ccacaattcagcaaattgtgaacatcatcacgttcatctttccctggttgccaatggcccattttcctgtcagtaacgagaaggtcgcgtattcaggcgctttttagactggtcgtaatgaa BBa_K1583012_sequence 1 ggcggtggcggtagcggtggcggtggcagt BBa_K1583013_sequence 1 ggtgttgttcctcagtacggcggcggcggtaaccacggtggtggcggtaataatagcggcccaaattctgagctgaacatttaccagtacggtggcggtaactctgcacttgctctgcaaactgatgcccgtaactctgacttgactattacccagcatggcggcggtaatggtgcagatgttggtcagggctcagatgacagctcaatcgatctgacccaacgtggcttcggtaacagcgctactcttgatcagtggaacggcaaaaattctgaaatgacggttaaacagttcggtggtggcaacggtgctgcggttgaccagactgcatctaactcctccgtcaacgtgactcaggttggctttggtaacaacgcgaccgctcatcagtac BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_K1583056_sequence 1 atactagagcagcaaggaaatactaga BBa_R0040_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcac BBa_K1583058_sequence 1 aggaggtatata BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_K1583002_sequence 1 atgagttctgaagaatacaaaggtggttattacccaggcaatacttaccactatcattcaggtggtagttatcacggatccggctatcatggaggatataagggaaagtattacggaaaggcaaagaaatactattataaatataaaaacagcggaaaatacaagtatctgaagaaagctagaaaataccatagaaagggttacaagaagtattatggaggtggtagcagt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z