BBa_G0002 1 SX scar SpeI/XbaI mixed site 2007-02-26T12:00:00Z 2015-08-31T04:07:27Z XbaI and SpeI sites XbaI/SpeI mixed site. Simply used to aid in entry of parts into the registry. false true _41_ 0 126 70 Not in stock false None. false Reshma Shetty BBa_K1583112 1 BBa_K1583112 pRha + CsgA & GFP in same operon 2015-09-14T11:00:00Z 2015-11-13T09:41:52Z This part was synthesized. The rhamnose promoter was used by the iGEM 2014 TU Delft team and originally added by the iGEM12 Paris Bettencourt team. RBS and CsgA originate from E. coli K-12 MG1655 CsgA is a protein monomer which can aggregate to form amyloid nanowires in natural biofilms taken from E.coli K-12 MG1655. The aggregation to the nanowire ('curli') is induced by the membrane protein CsgB. CsgC, CsgE, CsgF and CsgG act as chaperones for CsgA during translation and export to the extracellular space. This part was designed to measure intracellular expression rates of CsgA coupled to fluorescence (GFP) by cloning the biobrick I13504 into the same operon which is under control of the Rhamnose promoter. false false _2000_ 24465 24463 9 true The scar is a stop codon, but no terminator. Like this, cloning a GFP which contains an RBS we intended to directly couple CsgA expression to expression of GFP. false Stefan Robert Marsden, Max van 't Hof, Samantha Basalo Vazquez component2457335 1 BBa_I13504 component2457325 1 BBa_K1583100 annotation2457325 1 BBa_K1583100 range2457325 1 1 638 annotation2457335 1 BBa_I13504 range2457335 1 647 1521 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_K914003 1 BBa_K914003 L-rhamnose-inducible promoter (pRha) 2012-09-19T11:00:00Z 2015-05-08T01:13:45Z Amplification of the plasmid pJOE3075 (Dr. Altenbuchner). Released HQ 2013 L-rhamnose-inducible promoter is capable of high-level recombinant protein expression in the presence of L-rhamnose, it is also tightly regulated in the absence of L-rhamnose by the addition of D-glucose. false false _1179_ 0 13487 9 In stock true One base pair modified (90: A -> T) to avoid EcoRI site. Mutation made in a less conserved base pair. false Denis Samuylov annotation2188559 1 pRha range2188559 1 1 122 BBa_I13504 1 BBa_I13504 Screening plasmid intermediate 2005-05-30T11:00:00Z 2015-08-31T04:07:34Z Released HQ 2013 Built by Josh as an intermediate in screening plasmid construction. false true _11_ 0 253 6 In stock false true jkm component1505067 1 BBa_B0034 component1505074 1 BBa_B0010 component1505084 1 BBa_B0012 component1505069 1 BBa_E0040 annotation1505069 1 BBa_E0040 range1505069 1 19 738 annotation1505067 1 BBa_B0034 range1505067 1 1 12 annotation1505084 1 BBa_B0012 range1505084 1 835 875 annotation1505074 1 BBa_B0010 range1505074 1 747 826 BBa_E0040 1 GFP green fluorescent protein derived from jellyfish Aequeora victoria wild-type GFP (SwissProt: P42212 2004-09-29T11:00:00Z 2016-01-26T02:09:38Z Released HQ 2013 GFP (mut3b) [note that this part does not have a barcode] false true _11_1_ 4206 61 7 In stock false true jcbraff annotation1934520 1 GFP protein range1934520 1 1 720 BBa_K1583051 1 BBa_K1583051 Scar 2 2015-09-03T11:00:00Z 2015-09-18T07:34:25Z This scar is part of a synthesized construct. Scar in constructs BBa_K1583100 - BBa_K1583112 false false _2000_ 24478 24478 9 false This scar originates from the part BBa_K1316015, on which the composite part BBa_K1583100 is based. false Max van 't Hof annotation2475065 1 Scar range2475065 1 1 14 BBa_K1583050 1 BBa_K1583050 Scar 1 2015-09-03T11:00:00Z 2015-09-18T07:33:29Z This scar is part of a synthesized construct. Scar in constructs BBa_K1583100 - BBa_K1583112 false false _2000_ 24478 24478 9 false This scar originates from the part BBa_K1316015, on which the composite part BBa_K1583100 is based. false Max van 't Hof annotation2475064 1 Scar range2475064 1 1 25 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 annotation1686 1 T7 TE range1686 1 8 27 BBa_K1583000 1 BBa_K1583000 CsgA 2015-09-01T11:00:00Z 2015-09-02T09:46:13Z The DNA was synthesized. The sequence originates from the genomic DNA of E. coli K-12 MG1655 (http://www.ncbi.nlm.nih.gov/gene/949055). This gene encodes for the protein CsgA. CsgA is a curlin subunit that can self-assemble into curli after nucleation on CsgB. They are produced in an unpolymerized form and secreted from the cell. CsgA is naturally produced by e.g. E. coli K-12 MG1655 from the operon CsgBA. A second operon, CsgDEFG encodes four additional proteins that are required for the curli assembly and secretion. false false _2000_ 24478 24478 9 false The nucleotides encoding for the third and fourth amino acids of the gene are changed to improve the success change of synthesis false Max van 't Hof annotation2442926 1 CsgA range2442926 1 1 456 BBa_K1583008 1 BBa_K1583008 RBS 2015-09-03T11:00:00Z 2015-09-04T05:18:43Z Synthesized RBS false false _2000_ 24478 24478 9 false Based on RBS of BBa_K1316015. false Max van BBa_K1583100 1 BBa_K1583100 pRha + CsgA 2015-09-02T11:00:00Z 2015-09-18T11:09:29Z This part was synthesized. The rhamnose promoter was used by the iGEM 2014 TU Delft teama and originally added by the iGEM12 Paris Bettencourt team. RBS and CsgA originate from E. coli K-12 MG1655 CsgA under control of L-rhamnose-inducible promoter false false _2000_ 24478 24478 9 false The nucleotides encoding for the second and third amino acid of the CsgA gene were changed to optimize synthesis success. (silent mutations) false Max van 't Hof component2443485 1 BBa_K914003 component2443486 1 BBa_K1583050 component2443487 1 BBa_K1583008 component2443489 1 BBa_K1583000 component2443490 1 BBa_K1583051 component2443483 1 BBa_G0002 annotation2443490 1 BBa_K1583051 range2443490 1 625 638 annotation2443487 1 BBa_K1583008 range2443487 1 156 167 annotation2443485 1 BBa_K914003 range2443485 1 9 130 annotation2443486 1 BBa_K1583050 range2443486 1 131 155 annotation2443483 1 BBa_G0002 range2443483 1 1 8 annotation2443489 1 BBa_K1583000 range2443489 1 169 624 BBa_K1583051_sequence 1 ctactagaaggagg BBa_B0034_sequence 1 aaagaggagaaa BBa_K1583100_sequence 1 tactagagccacaattcagcaaattgtgaacatcatcacgttcatctttccctggttgccaatggcccattttcctgtcagtaacgagaaggtcgcgtattcaggcgctttttagactggtcgtaatgaatactagagcagcaaggaaatactagaaggaggtatataatgaaactgctgaaagtagcagcaattgcagcaatcgtattctccggtagcgctctggcaggtgttgttcctcagtacggcggcggcggtaaccacggtggtggcggtaataatagcggcccaaattctgagctgaacatttaccagtacggtggcggtaactctgcacttgctctgcaaactgatgcccgtaactctgacttgactattacccagcatggcggcggtaatggtgcagatgttggtcagggctcagatgacagctcaatcgatctgacccaacgtggcttcggtaacagcgctactcttgatcagtggaacggcaaaaattctgaaatgacggttaaacagttcggtggtggcaacggtgcagcagttgaccagactgcatctaactcctccgtcaacgtgactcaggttggctttggtaacaacgcgaccgctcatcagtactaactactagaaggagg BBa_K1583050_sequence 1 tactagagcagcaaggaaatactag BBa_K1583008_sequence 1 aaggaggtatat BBa_K914003_sequence 1 ccacaattcagcaaattgtgaacatcatcacgttcatctttccctggttgccaatggcccattttcctgtcagtaacgagaaggtcgcgtattcaggcgctttttagactggtcgtaatgaa BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_K1583000_sequence 1 atgaaactgctgaaagtagcagcaattgcagcaatcgtattctccggtagcgctctggcaggtgttgttcctcagtacggcggcggcggtaaccacggtggtggcggtaataatagcggcccaaattctgagctgaacatttaccagtacggtggcggtaactctgcacttgctctgcaaactgatgcccgtaactctgacttgactattacccagcatggcggcggtaatggtgcagatgttggtcagggctcagatgacagctcaatcgatctgacccaacgtggcttcggtaacagcgctactcttgatcagtggaacggcaaaaattctgaaatgacggttaaacagttcggtggtggcaacggtgcagcagttgaccagactgcatctaactcctccgtcaacgtgactcaggttggctttggtaacaacgcgaccgctcatcagtactaa BBa_K1583112_sequence 1 tactagagccacaattcagcaaattgtgaacatcatcacgttcatctttccctggttgccaatggcccattttcctgtcagtaacgagaaggtcgcgtattcaggcgctttttagactggtcgtaatgaatactagagcagcaaggaaatactagaaggaggtatataatgaaactgctgaaagtagcagcaattgcagcaatcgtattctccggtagcgctctggcaggtgttgttcctcagtacggcggcggcggtaaccacggtggtggcggtaataatagcggcccaaattctgagctgaacatttaccagtacggtggcggtaactctgcacttgctctgcaaactgatgcccgtaactctgacttgactattacccagcatggcggcggtaatggtgcagatgttggtcagggctcagatgacagctcaatcgatctgacccaacgtggcttcggtaacagcgctactcttgatcagtggaacggcaaaaattctgaaatgacggttaaacagttcggtggtggcaacggtgcagcagttgaccagactgcatctaactcctccgtcaacgtgactcaggttggctttggtaacaacgcgaccgctcatcagtactaactactagaaggaggtactagagaaagaggagaaatactagatgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_I13504_sequence 1 aaagaggagaaatactagatgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_E0040_sequence 1 atgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataa BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_G0002_sequence 1 tactagag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z