BBa_K1583018 1 BBa_K1583018 SpyCatcher without startcodon + His-tag 2015-09-13T11:00:00Z 2015-09-14T01:44:54Z This gene was synthesized as part of biobrick BBa_K1583113. The idea of using Spytag/SpyCatcher was based on the paper "Programmable biofilm-based materials fromengineered curli nanofibres"[1] 1. Nguyen, P. Q., Botyanszki, Z., Tay, P. K. R., & Joshi, N. S. (2014). Programmable biofilm-based materials from engineered curli nanofibres. Nature communications, 5. SpyCatcher is a protein that can spontaneously form covalent isopeptide linkages with it??s counterpart `Spytag` under physiological conditions. false false _2000_ 24478 24478 9 false Startcodon was not included, since BFP (BBa_K1583017) was placed in front of this biobrick. false Max van 't Hof annotation2453887 1 His-tag range2453887 1 388 405 annotation2453888 1 Stop-codon range2453888 1 406 408 annotation2453886 1 SpyCatcher range2453886 1 1 387 BBa_K206000 1 pBAD pBAD strong 2009-10-13T11:00:00Z 2015-05-08T01:11:23Z The sequence was obtained by applying all mutations that upregulated AraC binding and subsequent promoter activity listed in reference [1]. Released HQ 2013 pBAD is an <i>E.coli</i> promoter that is induced by L-arabinose. K206000 is a mutagenized pBAD promoter that is responsive to lower concentrations of arabinose than wild type (<partinfo>I13453</partinfo>) and, additionally, exhibits a higher maximum of protein expression as measured by coupling to a fluorescent reporter. false false _307_ 0 4172 9 In stock true There were no special design considerations. false Amelia Hardjasa annotation2049253 1 AraI1 range2049253 1 40 57 annotation2049252 1 promoter range2049252 1 1 131 annotation2049254 1 AraI2 range2049254 1 61 78 BBa_G0002 1 SX scar SpeI/XbaI mixed site 2007-02-26T12:00:00Z 2015-08-31T04:07:27Z XbaI and SpeI sites XbaI/SpeI mixed site. Simply used to aid in entry of parts into the registry. false true _41_ 0 126 70 Not in stock false None. false Reshma Shetty BBa_K1583113 1 BBa_K1583113 pAra + fusion protein BFP_Spycatcher_His 2015-09-13T11:00:00Z 2015-09-17T05:21:01Z These part was synthesized as linear DNA and only restriction/ligation was done to insert this into the backbone. Inducible arabinose promoter controlling expression of BFP_SpyCatcher_His. false false _2000_ 24478 24478 9 false The start condon of SpyCatcher and the stop codon of BFP needed to be removed to ensure that one complete protein was expressed. false Max van component2454215 1 BBa_K206000 component2454218 1 BBa_K1583017 component2454222 1 BBa_K1583018 component2454216 1 BBa_G0002 component2454211 1 BBa_K1583054 component2454217 1 BBa_K1583061 annotation2454222 1 BBa_K1583018 range2454222 1 861 1268 annotation2454218 1 BBa_K1583017 range2454218 1 162 860 annotation2454215 1 BBa_K206000 range2454215 1 7 136 annotation2454211 1 BBa_K1583054 range2454211 1 1 6 annotation2454216 1 BBa_G0002 range2454216 1 137 144 annotation2454217 1 BBa_K1583061 range2454217 1 147 158 BBa_K1583061 1 BBa_K1583061 RBS 2015-09-07T11:00:00Z 2015-09-08T07:43:48Z The DNA was synthesized. The sequence originates from the genomic DNA of E. coli K-12 MG1655 (http://www.ncbi.nlm.nih.gov/gene/949055). The design was based on the paper "Strong underwater adhesives made by self-assembling multi-protein nanofibres".[1] 1. C.Zhong, T.Gurry, A.Cheng, J.Downey, Z.Deng, C. Stultz, T.Lu, Nature Nanotechnology, 2014, 9, 858-866. This RBS was used in our constructs Mfp5+CsgA and CsgA+Mfp3. CsgA is a protein monomer which can aggregate to form amyloid nanowires in natural biofilms taken from E.coli K-12 MG1655. Inspired by mussels, the Mfp5 (mussel foot protein) has high adhesive properties towards wet polar surfaces. This DNA was synthesized. The design was based on the paper "Strong underwater adhesives made by self-assembling multi-protein nanofibres".[1] 1. C.Zhong, T.Gurry, A.Cheng, J.Downey, Z.Deng, C. Stultz, T.Lu, Nature Nanotechnology, 2014, 9, 858-866. false false _2000_ 24463 24463 9 false The design was based on the paper "Strong underwater adhesives made by self-assembling multi-protein nanofibres".[1] 1. C.Zhong, T.Gurry, A.Cheng, J.Downey, Z.Deng, C. Stultz, T.Lu, Nature Nanotechnology, 2014, 9, 858-866. false Stefan Robert Marsden annotation2475161 1 RBS range2475161 1 1 12 BBa_K1583054 1 BBa_K1583054 Non-coding scar site in between RBS and gene 2015-09-03T11:00:00Z 2015-09-18T08:03:55Z The RBS and CsgC were synthesized from the genomic sequence of E.coli K-12 MG1655. The promoter is part of the constitutive promoter family made by John Anderson from iGEM Berkeley 2006. CsgC is positively involved in the extracellular aggregation of CsgA into amyloid nanowires (curli assembly) in E.coli functioning as a chaperone for CsgA. false false _2000_ 24478 24463 9 false We inserted non-coding scar sequences after the promoter and RBS to prevent missing initial codons during transcription/translation. false Stefan Robert Marsden annotation2475152 1 Scar range2475152 1 1 6 BBa_K1583017 1 BBa_K1583017 Blue Fluorescent Protein (mTagBFP) without stopcodon 2015-09-13T11:00:00Z 2016-01-25T01:00:29Z Part was developed by iGEM11_Uppsala-Sweden. It was produced by synthesis of part BBa_K1583113 Biobrick part BBa_K592100 of the 2011 iGEM Uppsala team, without stopcodon. false false _2000_ 4206 24478 9 false The original stop codon needed to be removed to be able to attach SpyCatcher and His-tag. false Max van 't Hof annotation2474939 1 BFP range2474939 1 1 699 BBa_K1583061_sequence 1 aaagaggagaaa BBa_K1583054_sequence 1 tactag BBa_K1583017_sequence 1 atgagcgaactgatcaaagagaacatgcacatgaagctgtacatggaaggcaccgttgacaaccaccactttaagtgcacgtctgagggtgagggtaagccgtacgaaggcacccaaaccatgcgtatcaaagttgtggagggcggtccactgccgttcgcttttgacattctggcgaccagcttcctgtacggttccaaaacgttcattaaccatactcagggcattccggatttcttcaaacagagctttccggaaggtttcacctgggagcgtgtcaccacgtatgaagatggtggtgtgttgaccgccacccaagatacctccctgcaagatggctgtctgatctataacgtgaaaattcgtggcgtcaactttacgagcaatggtccggtgatgcagaagaaaaccctgggttgggaggcgtttacggaaaccctgtatccggccgatggtggcctggagggccgtaacgacatggcactgaagctggttggtggcagccatttgatcgcaaatatcaagacgacgtaccgcagcaagaaaccggcgaaaaatctgaagatgccgggtgtttactatgtcgactaccgtctggaacgcattaaagaagcgaataatgagacttacgtggagcagcacgaggttgcagtcgcgcgctattgcgacttgcctagcaagctgggtcataaactgaat BBa_K1583018_sequence 1 gattacgacatcccaacgaccgaaaacctgtattttcagggcgccatggttgataccttatcaggtttatcaagtgagcaaggtcagtccggtgatatgacaattgaagaagatagtgctacccatattaaattctcaaaacgtgatgaggacggcaaagagttagctggtgcaactatggagttgcgtgattcatctggtaaaactattagtacatggatttcagatggacaagtgaaagatttctacctgtatccaggaaaatatacatttgtcgaaaccgcagcaccagacggttatgaggtagcaactgctattacctttacagttaatgagcaaggtcaggttactgtaaatggcaaagcaactaaaggtgacgctcatattcatcatcaccatcaccactaa BBa_K206000_sequence 1 acattgattatttgcacggcgtcacactttgctatgccatagcaagatagtccataagattagcggatcctacctgacgctttttatcgcaactctctactgtttctccataccgtttttttgggctagc BBa_K1583113_sequence 1 tactagacattgattatttgcacggcgtcacactttgctatgccatagcaagatagtccataagattagcggatcctacctgacgctttttatcgcaactctctactgtttctccataccgtttttttgggctagctactagagaaaaagaggagaaatacatgagcgaactgatcaaagagaacatgcacatgaagctgtacatggaaggcaccgttgacaaccaccactttaagtgcacgtctgagggtgagggtaagccgtacgaaggcacccaaaccatgcgtatcaaagttgtggagggcggtccactgccgttcgcttttgacattctggcgaccagcttcctgtacggttccaaaacgttcattaaccatactcagggcattccggatttcttcaaacagagctttccggaaggtttcacctgggagcgtgtcaccacgtatgaagatggtggtgtgttgaccgccacccaagatacctccctgcaagatggctgtctgatctataacgtgaaaattcgtggcgtcaactttacgagcaatggtccggtgatgcagaagaaaaccctgggttgggaggcgtttacggaaaccctgtatccggccgatggtggcctggagggccgtaacgacatggcactgaagctggttggtggcagccatttgatcgcaaatatcaagacgacgtaccgcagcaagaaaccggcgaaaaatctgaagatgccgggtgtttactatgtcgactaccgtctggaacgcattaaagaagcgaataatgagacttacgtggagcagcacgaggttgcagtcgcgcgctattgcgacttgcctagcaagctgggtcataaactgaatgattacgacatcccaacgaccgaaaacctgtattttcagggcgccatggttgataccttatcaggtttatcaagtgagcaaggtcagtccggtgatatgacaattgaagaagatagtgctacccatattaaattctcaaaacgtgatgaggacggcaaagagttagctggtgcaactatggagttgcgtgattcatctggtaaaactattagtacatggatttcagatggacaagtgaaagatttctacctgtatccaggaaaatatacatttgtcgaaaccgcagcaccagacggttatgaggtagcaactgctattacctttacagttaatgagcaaggtcaggttactgtaaatggcaaagcaactaaaggtgacgctcatattcatcatcaccatcaccactaaat BBa_G0002_sequence 1 tactagag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z