BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_K1583202 1 BBa_K1583202 High constitutive promoter + CsgC 2015-09-03T11:00:00Z 2016-01-25T11:28:39Z The RBS and CsgC were synthesized from the genomic sequence of E.coli K-12 MG1655. The promoter is part of the constitutive promoter family made by John Anderson from iGEM Berkeley 2006.Non-coding scar sites were designed at random. CsgC is positively involved in the extracellular aggregation of CsgA into amyloid nanowires (curli assembly) in E.coli functioning as a chaperone for CsgA. Constructs with different promoter strenghts were designed to investigate the impact on nanowire self-assembly. false false _2000_ 4206 24463 9 false We inserted non-coding scar sequences after the promoter and RBS to prevent missing initial codons during transcription/translation. false Stefan Robert Marsden component2443507 1 BBa_K1088022 component2443508 1 BBa_K1583001 component2443503 1 BBa_J23100 component2443506 1 BBa_B0034 component2443504 1 BBa_K1583053 annotation2443506 1 BBa_B0034 range2443506 1 54 65 annotation2443508 1 BBa_K1583001 range2443508 1 72 404 annotation2443504 1 BBa_K1583053 range2443504 1 36 53 annotation2443507 1 BBa_K1088022 range2443507 1 66 71 annotation2443503 1 BBa_J23100 range2443503 1 1 35 BBa_K1583001 1 BBa_K1583001 CsgC 2015-09-03T11:00:00Z 2015-09-18T06:36:25Z The RBS and CsgC were synthesized from the genomic sequence of E.coli K-12 MG1655. The promoter is part of the constitutive promoter family made by John Anderson from iGEM Berkeley 2006. CsgC is positively involved in the extracellular aggregation of CsgA into amyloid nanowires (curli assembly) in E.coli functioning as a chaperone for CsgA. false false _2000_ 24478 24463 9 false We inserted non-coding scar sequences after the promoter and RBS to prevent missing initial codons during transcription/translation. false Stefan Robert Marsden annotation2474746 1 CsgC range2474746 1 1 333 BBa_K1583053 1 BBa_K1583053 Non-coding scar site in between promoter and RBS 2015-09-03T11:00:00Z 2015-09-18T07:32:56Z The RBS and CsgC were synthesized from the genomic sequence of E.coli K-12 MG1655. The promoter is part of the constitutive promoter family made by John Anderson from iGEM Berkeley 2006. CsgC is positively involved in the extracellular aggregation of CsgA into amyloid nanowires (curli assembly) in E.coli functioning as a chaperone for CsgA. false false _2000_ 24478 24463 9 false We inserted non-coding scar sequences after the promoter and RBS to prevent missing initial codons during transcription/translation. false Stefan Robert Marsden annotation2475063 1 Scar range2475063 1 1 18 BBa_J23100 1 BBa_J23100 constitutive promoter family member 2006-08-03T11:00:00Z 2015-08-31T04:08:40Z Isolated from library of promoters Released HQ 2013 Replace later false true _52_ 0 483 95 In stock true N/A true John Anderson BBa_K1088022 1 BBa_K1088022 TACTAG 2013-09-16T11:00:00Z 2015-05-08T01:09:06Z TACTAG Short DNA piece (TACTAG) false false _1398_ 0 17057 9 Not in stock false 6 random nucleotides false Patrick Rosendahl Andreassen BBa_J23100_sequence 1 ttgacggctagctcagtcctaggtacagtgctagc BBa_K1088022_sequence 1 tactag BBa_B0034_sequence 1 aaagaggagaaa BBa_K1583202_sequence 1 ttgacggctagctcagtcctaggtacagtgctagctactagagggcttactaaaaagaggagaaatactagatgaatacgttattactccttgcggcactttccagtcagataacctttaatacgacccagcaaggggatgtgtataccattattcctgaagtcactcttactcaatcttgtctgtgcagagtacaaatattgtccctgcgcgaaggcagttcagggcaaagtcagacgaagcaagaaaagaccctttcattgcctgctaatcaacccattgctttgacgaagttgagtttaaatatttccccggacgatcgggtgaaaatagttgttactgtttctgatggacagtcacttcatttatcacaacaatggccgccctcttcagaaaagtcttaa BBa_K1583001_sequence 1 atgaatacgttattactccttgcggcactttccagtcagataacctttaatacgacccagcaaggggatgtgtataccattattcctgaagtcactcttactcaatcttgtctgtgcagagtacaaatattgtccctgcgcgaaggcagttcagggcaaagtcagacgaagcaagaaaagaccctttcattgcctgctaatcaacccattgctttgacgaagttgagtttaaatatttccccggacgatcgggtgaaaatagttgttactgtttctgatggacagtcacttcatttatcacaacaatggccgccctcttcagaaaagtcttaa BBa_K1583053_sequence 1 tactagagggcttactaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z