BBa_K1583053 1 BBa_K1583053 Non-coding scar site in between promoter and RBS 2015-09-03T11:00:00Z 2015-09-18T07:32:56Z The RBS and CsgC were synthesized from the genomic sequence of E.coli K-12 MG1655. The promoter is part of the constitutive promoter family made by John Anderson from iGEM Berkeley 2006. CsgC is positively involved in the extracellular aggregation of CsgA into amyloid nanowires (curli assembly) in E.coli functioning as a chaperone for CsgA. false false _2000_ 24478 24463 9 false We inserted non-coding scar sequences after the promoter and RBS to prevent missing initial codons during transcription/translation. false Stefan Robert Marsden annotation2475063 1 Scar range2475063 1 1 18 BBa_K1583016 1 BBa_K1583016 CsgB 2015-09-07T11:00:00Z 2015-09-08T08:52:11Z The DNA was synthesized. The sequence originates from the genomic DNA of E. coli K-12 MG1655 (http://www.ncbi.nlm.nih.gov/gene/949055). CsgA is a protein monomer which can aggregate to foCsgB functions as the anchor on the cell wall for curli nanowires. It triggers the aggregation of CsgA and leads to the formation of amyloid nanowires. CsgC is positively involved in the extracellular aggregation of CsgA into amyloid nanowires (curli assembly) in E.coli functioning as a chaperone for CsgA. false false _2000_ 24463 24463 9 false No special design considerations. false Stefan Robert Marsden BBa_K1583054 1 BBa_K1583054 Non-coding scar site in between RBS and gene 2015-09-03T11:00:00Z 2015-09-18T08:03:55Z The RBS and CsgC were synthesized from the genomic sequence of E.coli K-12 MG1655. The promoter is part of the constitutive promoter family made by John Anderson from iGEM Berkeley 2006. CsgC is positively involved in the extracellular aggregation of CsgA into amyloid nanowires (curli assembly) in E.coli functioning as a chaperone for CsgA. false false _2000_ 24478 24463 9 false We inserted non-coding scar sequences after the promoter and RBS to prevent missing initial codons during transcription/translation. false Stefan Robert Marsden annotation2475152 1 Scar range2475152 1 1 6 BBa_K1583001 1 BBa_K1583001 CsgC 2015-09-03T11:00:00Z 2015-09-18T06:36:25Z The RBS and CsgC were synthesized from the genomic sequence of E.coli K-12 MG1655. The promoter is part of the constitutive promoter family made by John Anderson from iGEM Berkeley 2006. CsgC is positively involved in the extracellular aggregation of CsgA into amyloid nanowires (curli assembly) in E.coli functioning as a chaperone for CsgA. false false _2000_ 24478 24463 9 false We inserted non-coding scar sequences after the promoter and RBS to prevent missing initial codons during transcription/translation. false Stefan Robert Marsden annotation2474746 1 CsgC range2474746 1 1 333 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_K1583055 1 BBa_K1583055 Non-coding sequence in between a gene and the next RBS 2015-09-03T11:00:00Z 2015-09-18T08:05:09Z The RBS and CsgC were synthesized from the genomic sequence of E.coli K-12 MG1655. The promoter is part of the constitutive promoter family made by John Anderson from iGEM Berkeley 2006.Non-coding scar sites were designed at random. CsgB functions as the anchor on the cell wall for curli nanowires. It triggers the aggregation of CsgA and leads to the formation of amyloid nanowires. CsgC is positively involved in the extracellular aggregation of CsgA into amyloid nanowires (curli assembly) in E.coli functioning as a chaperone for CsgA. Constructs with different promoter strenghts were designed to investigate the impact on nanowire self-assembly. false false _2000_ 24478 24463 9 false We inserted non-coding scar sequences after the promoter and RBS to prevent missing initial codons during transcription/translation. false Stefan Robert Marsden annotation2475154 1 Scar range2475154 1 1 14 BBa_K1583205 1 BBa_K1583205 High constitutive promoter + CsgB & CsgC 2015-09-03T11:00:00Z 2016-01-25T11:29:31Z The RBS and CsgC were synthesized from the genomic sequence of E.coli K-12 MG1655. The promoter is part of the constitutive promoter family made by John Anderson from iGEM Berkeley 2006.Non-coding scar sites were designed at random. CsgB functions as the anchor on the cell wall for curli nanowires. It triggers the aggregation of CsgA and leads to the formation of amyloid nanowires. CsgC is positively involved in the extracellular aggregation of CsgA into amyloid nanowires (curli assembly) in E.coli functioning as a chaperone for CsgA. Constructs with different promoter strenghts were designed to investigate the impact on nanowire self-assembly. Medium expression level. false false _2000_ 4206 24463 9 false We inserted non-coding scar sequences after the promoter and RBS to prevent missing initial codons during transcription/translation. false Stefan Robert Marsden component2458789 1 BBa_K1583001 component2458785 1 BBa_K1583055 component2458780 1 BBa_J23100 component2458787 1 BBa_B0034 component2458782 1 BBa_K1583058 component2458781 1 BBa_K1583053 component2458788 1 BBa_K1583054 component2458784 1 BBa_K1583016 component2458783 1 BBa_K1583054 annotation2458785 1 BBa_K1583055 range2458785 1 528 541 annotation2458782 1 BBa_K1583058 range2458782 1 54 65 annotation2458784 1 BBa_K1583016 range2458784 1 72 527 annotation2458788 1 BBa_K1583054 range2458788 1 554 559 annotation2458789 1 BBa_K1583001 range2458789 1 560 892 annotation2458787 1 BBa_B0034 range2458787 1 542 553 annotation2458781 1 BBa_K1583053 range2458781 1 36 53 annotation2458783 1 BBa_K1583054 range2458783 1 66 71 annotation2458780 1 BBa_J23100 range2458780 1 1 35 BBa_J23100 1 BBa_J23100 constitutive promoter family member 2006-08-03T11:00:00Z 2015-08-31T04:08:40Z Isolated from library of promoters Released HQ 2013 Replace later false true _52_ 0 483 95 In stock true N/A true John Anderson BBa_K1583058 1 BBa_K1583058 RBS 2015-09-03T11:00:00Z 2015-09-04T06:58:12Z 1. C.Zhong, T.Gurry, A.Cheng, J.Downey, Z.Deng, C. Stultz, T.Lu, Nature Nanotechnology, 2014, 9, 858-866. This RBS was used in the article "Strong underwater adhesives made by self-assembling multi-protein nanofibres". 1. C.Zhong, T.Gurry, A.Cheng, J.Downey, Z.Deng, C. Stultz, T.Lu, Nature Nanotechnology, 2014, 9, 858-866. false false _2000_ 24463 24463 9 false No special design considerations were made. false Stefan Robert Marsden annotation2475160 1 RBS range2475160 1 1 12 BBa_J23100_sequence 1 ttgacggctagctcagtcctaggtacagtgctagc BBa_B0034_sequence 1 aaagaggagaaa BBa_K1583001_sequence 1 atgaatacgttattactccttgcggcactttccagtcagataacctttaatacgacccagcaaggggatgtgtataccattattcctgaagtcactcttactcaatcttgtctgtgcagagtacaaatattgtccctgcgcgaaggcagttcagggcaaagtcagacgaagcaagaaaagaccctttcattgcctgctaatcaacccattgctttgacgaagttgagtttaaatatttccccggacgatcgggtgaaaatagttgttactgtttctgatggacagtcacttcatttatcacaacaatggccgccctcttcagaaaagtcttaa BBa_K1583205_sequence 1 ttgacggctagctcagtcctaggtacagtgctagctactagagggcttactaaaggaggtatatatactagatgaaaaacaaattgttatttatgatgttaacaatactgggtgcgcctgggattgcagccgcagcaggttatgatttagctaattcagaatataacttcgcggtaaatgaattgagtaagtcttcatttaatcaggcagccataattggtcaagctgggactaataatagtgctcagttacggcagggaggctcaaaacttttggcggttgttgcgcaagaaggtagtagcaaccgggcaaagattgaccagacaggagattataaccttgcatatattgatcaggcgggcagtgccaacgatgccagtatttcgcaaggtgcttatggtaatactgcgatgattatccagaaaggttctggtaataaagcaaatattacacagtatggtactcaaaaaacggcaattgtagtgcagagacagtcgcaaatggctattcgcgtgacacaacgttaatttccattcgacttaaagaggagaaatactagatgaatacgttattactccttgcggcactttccagtcagataacctttaatacgacccagcaaggggatgtgtataccattattcctgaagtcactcttactcaatcttgtctgtgcagagtacaaatattgtccctgcgcgaaggcagttcagggcaaagtcagacgaagcaagaaaagaccctttcattgcctgctaatcaacccattgctttgacgaagttgagtttaaatatttccccggacgatcgggtgaaaatagttgttactgtttctgatggacagtcacttcatttatcacaacaatggccgccctcttcagaaaagtcttaa BBa_K1583053_sequence 1 tactagagggcttactaa BBa_K1583054_sequence 1 tactag BBa_K1583055_sequence 1 tttccattcgactt BBa_K1583058_sequence 1 aggaggtatata BBa_K1583016_sequence 1 atgaaaaacaaattgttatttatgatgttaacaatactgggtgcgcctgggattgcagccgcagcaggttatgatttagctaattcagaatataacttcgcggtaaatgaattgagtaagtcttcatttaatcaggcagccataattggtcaagctgggactaataatagtgctcagttacggcagggaggctcaaaacttttggcggttgttgcgcaagaaggtagtagcaaccgggcaaagattgaccagacaggagattataaccttgcatatattgatcaggcgggcagtgccaacgatgccagtatttcgcaaggtgcttatggtaatactgcgatgattatccagaaaggttctggtaataaagcaaatattacacagtatggtactcaaaaaacggcaattgtagtgcagagacagtcgcaaatggctattcgcgtgacacaacgttaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z