BBa_K1586001 1 GreenFET1T Synthetic toehold riboswitch - T7 2015-09-09T11:00:00Z 2015-09-18T11:24:30Z The sequence of this part was designed by and characterised in cells by Green et al. 2014 (http://www.sciencedirect.com/science/article/pii/S0092867414012896; supplementary information, table 3, Forward Engineered Toehold 1). A toehold switch is a type of RNA molecule known as a riboregulator/riboswitch. It is able to detect the presence of a specific ssRNA molecule (termed the 'trigger RNA') which has a sequence complementary to its switch region through base pairing. If the correct RNA molecule is detected, the protein coding region attached to the toehold switch is expressed. A toehold switch is unique from other types of riboswitches as it is completely synthetic, and therefore easier to engineer and standardise. The fact that the toehold switch can be modified means that the switch region can be changed to detect any given trigger RNA molecule, and the protein coding region can be swapped for any desired reporter protein for easy measurement/visualisation. Toehold switches can be used to detect specific RNA molecules in a cell-free system, or transformed into cells in order to ascertain whether a gene is being expressed (through detection of its mRNA). The applications of this technology can range from a research tool (e.g. detection of secreted RNA in cell supernatant, detection of gene expression, etc.), through to more commercial/medical applications such as diagnostic testing. Part K1586000 encodes for a toehold switch forward engineered by Green et al. (2014). This toehold switch is under the control of a J23100 promoter and contains a double terminator. It is designed to detect a synthetic RNA trigger (GGGACUGACUAUUCUGUGCAAUAGUCAGUAAAGCAGGGAUAAACGAGAUAGAUAAGAUAAGAUAG) and produces GFP when activated. This toehold switch contains non-standard ribosome binding site (RBS) and GFP reporter protein and has an intended use as a control. Part K1586003 encodes a more standardised toehold switch. false false _2003_ 24485 24485 9 false The first 12 nucleotides of the toehold (not including the GGG leader sequence) should not form a part of the toehold stem. The majority of the RBS should be within the loop region of the toehold. There must not be an inframe stop codon within the main linker sequence. The linker sequence length must be a multiple of three. false Exeter iGEM 2015 annotation2473319 1 T7 terminator range2473319 1 867 921 annotation2473304 1 GFP range2473304 1 108 866 annotation2473323 1 Stem-loop range2473323 1 33 81 annotation2473302 1 Switch region range2473302 1 21 47 annotation2473301 1 GGG leader sequence range2473301 1 18 20 annotation2473303 1 Translated region range2473303 1 75 866 annotation2448791 1 T7 range2448791 1 1 17 BBa_K1586001_sequence 1 taatacgactcactatagggtcttatcttatctatctcgtttatccctgcatacagaaacagaggagatatgcaatgataaacgagaacctggcggcagcgcaaaagatgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccgtggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcacatgaaacagcatgactttttcaagagtgccatgcccgaaggttacgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccgattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaaccgctgctgggattacacatggcatggatgaactatacaaaaggcctacagcaaacgacgaaaactacgctgcatcagtttaataaatttaaattagcataaccccttggggcctctaaacgggtcttgaggggttttttg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z