BBa_K1590000 1 BBa_K1590000 Human Haemoglobin A 2015-09-07T11:00:00Z 2015-09-18T03:43:42Z In silico optimised version for E. coli K12 strains. Sequence ordered through IDT. Coding sequences for human Haemoglobin A. Forms a tetramer consisting of 2 A-chains and 2B-chains (See BBa_K1590001 for Haemboglobin B). Binds to Haptoglobin (BBa_K1590002). It is still being tested if Haptoglobin interacts with either single chain, or if it only binds to the complex. false false _2007_ 8083 24715 9 No part sequence false Choosing the correct codon-bias, remove 'illegal' restriction sites, ensure that (stop)codons are in frame, addition of standard prefix and suffix. false Manuel Blank annotation2447339 1 ATG Start-codon range2447339 1 1 3 annotation2447341 1 TAA Stop-codon range2447341 1 427 429 annotation2447340 1 Human Haemoglobin A Protein Coding Sequence range2447340 1 1 426 BBa_K1590000_sequence 1 atggttctgtctccggcggacaaaaccaacgttaaagcggcgtggggtaaagttggtgcgcacgcgggtgaatacggtgcggaagcgctggaacgtatgttcctgtctttcccgaccaccaaaacctacttcccgcacttcgacctgtctcacggttctgcgcaggttaaaggtcacggtaaaaaagttgcggacgcgctgaccaacgcggttgcgcacgttgacgacatgccgaacgcgctgtctgcgctgtctgacctgcacgcgcacaaactgcgtgttgacccggttaacttcaaactgctgtctcactgcctgctggttaccctggcggcgcacctgccggcggagttcaccccggcggttcacgcgtctctggacaaattcctggcgtctgtttctaccgttctgacctctaaataccgttaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z