BBa_K1590001 1 BBa_K1590001 Human Haemoglobin B 2015-09-07T11:00:00Z 2015-09-18T03:44:54Z In silico optimised version for E. coli K12 strains. Sequence ordered through IDT. Coding sequences for human Haemoglobin B. Forms a tetramer consisting of 2 A-chains and 2B-chains (See BBa_K1590000 for Haemboglobin A). Binds to Haptoglobin (BBa_K1590002). It is still being tested if Haptoglobin interacts with either single chain, or if it only binds to the complex. false false _2007_ 8083 24715 9 false Choosing the correct codon-bias, removing 'illegal' restriction sites, ensure that codons are in frame, addition of standard prefix and suffix. false Manuel Blank annotation2447342 1 ATG start-codon range2447342 1 1 3 annotation2447343 1 Human Haemoglobin B Protein Coding Sequence range2447343 1 1 441 annotation2447344 1 TAA stop codon range2447344 1 442 444 BBa_K1590001_sequence 1 atggttcacctgaccccggaagaaaaatctgcggttaccgcgctgtggggtaaagttaacgttgacgaagttggtggtgaagcgctgggtcgtctgctggttgtttacccgtggacccagcgtttcttcgaatctttcggtgacctgtctaccccggacgcggttatgggtaacccgaaagttaaagcgcacggtaaaaaagttctgggtgcgttctctgacggtctggcgcacctggacaacctgaaaggcaccttcgcgaccctgtctgaactgcactgcgacaaactgcacgttgacccggaaaacttccgtctgctgggtaacgttctggtttgcgttctggcgcaccacttcggtaaagagttcaccccgccggttcaggcggcgtaccagaaagttgttgcgggtgttgcgaacgcgctggcgcacaaataccactaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z