BBa_K1590003 1 BBa_K1590003 Chromate responsive promoter 2015-09-08T11:00:00Z 2015-09-18T03:49:07Z PCR-amplification from biobrick BBa_K1058008 (pChrBGFP). The promoter pChr is suspected to be inducible by chromate. false false _2007_ 8083 24715 9 false The promoter was excised as a separate part in order to build a chromate-inducible fluorescent reporter. Primers for amplification of pChr from BBa_K1058008. Forward: GCGC GAATTCGCGGCCGCTTCTAGAG ATTGCTTATTCCTATTGC Reverse: GCGC CTGCAGCGGCCGCTACTAGT AGTCGTAGATGTTACTACA false Manuel Blank annotation2447679 1 putative repressor binding site range2447679 1 133 165 BBa_K1590003_sequence 1 attgcttattcctattgccatttgcttttattttgcaatacgttttagcaacgcacaacaccttatgggtgtgctgcttccattgtgattgcgcaaatgtccgtttttgcaatctactcaagactttatttcgtagatcttatctcattattgtagtaacatctacgac igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z