BBa_K1592000 1 BBa_K1592000 LIP2 prepro(signal peptide) 2015-08-27T11:00:00Z 2015-09-18T09:23:12Z It have been contributed from our lab. The pre-region of lipase 2 from Yarrowia lipolytica corresponds to the signal sequence; the dipeptides XA and XP are substrates for diamino-peptidase; the dibasic KR cleavage site is substrate for Xpr6p endoproteinase. false false _2009_ 20267 20267 9 false No. false Shuyan Tang annotation2444445 1 LIP2 pre range2444445 1 1 39 annotation2444447 1 LIP2 pro range2444447 1 64 93 annotation2455904 1 Start codon range2455904 1 1 3 annotation2444448 1 KR cleavage site range2444448 1 94 99 annotation2444446 1 4 XA or XP range2444446 1 40 63 BBa_K1592000_sequence 1 atgaagctttccaccatccttttcacagcctgcgctaccctggctgccgccctcccttcccccatcactccttctgaggccgcagttctccagaagcga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z