BBa_K1592001 1 Mcfp3 Mytilus californianus foot protein 3(Mcfp3) variant 3　 2015-08-29T11:00:00Z 2015-09-18T09:23:37Z We got the LIP prepro and YLcwp3 sequence from our lab, and synthetize the E. coli ribosomal protein L2 (1-60) by IDT. This is the cell display system of Yarrowia lipolytica, composed of LIP prepro, interest protein, and YLcwp3. LIP prepro is signal peptide used to secrete the interest protein out of the cell, and the YLcwp3 is the anchor domain binding the interest protein to the cell wall of yeast. We use this system to display silica-tag and test its binding characteristics. E.coli ribosomal protein L2 was found to bind tightly to silicon particles, which have surfaces that are oxidized to silica. This L2 silica-binding tag, called the ??????Si-tag,?????? can be used for one-step targeting of functional proteins on silica surfaces. The silica-binding domains of E. coli L2 was mapped to amino acids 1???60, 61-202 and 203???273. We respectively test the silica-binding characteristics of this three regions and their combinations. E. coli ribosomal protein L2 (1-60) is the amino acids 1???60 of E. coli ribosomal protein L2, we call it si-tag1. false false _2009_ 20267 20267 9 true No. false Shuyan Tang annotation2455905 1 Start codon range2455905 1 1 3 BBa_K1592001_sequence 1 atgaataaattcagtgtcacagttttgctggctttagtccttattggattttttgccgttcagagtgacgcaggttatggttatgatctaggatataatgcaccatggccatacaacaatggttactatggctataatggatacaatggatatcacggacgttatggctggaataaaggctggaataacggtccatggggaggatcatattatggaaacaaaggctatttgtat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z