BBa_K1592002 1 YLcwp3 Yarrowia lipolytica cell wall protein 3 2015-08-30T11:00:00Z 2015-09-18T09:24:05Z The source of the part will be its sequence which was retrieved from GenBank, and altered some regions by our lab. The covalently bound GPI-anchored cell wall protein of Y. lipolytica Ylcwp1 has been isolated and characterized (Jaafar and Zueco 2004). The nucleotide sequence encoding 110 amino acids of the Ylcwp1 C terminus has been utilized for the construction of the cell surface display vector in Y. lipolytica (Yue et al. 2008). This system was successfully used to immobilize green fluorescent protein (Yue et al. 2008). The ability of five new putative covalently linked cell wall proteins of Y. lipolytica -Ylcwp1, Ylcwp2, Ylcwp3, Ylcwp4, Ylcwp5, was tested and the highest cell-bound lipase value was obtained with the anchor domains Ylcwp3 (Evgeniya et al. 2011), so we utilized the YLcwp3 for the cell surface display in Y. lipolytica. false false _2009_ 20267 20267 9 false No false Shuyan Tang BBa_K1592002_sequence 1 ctcggctttgccgctcgagctgtcttcgaaggtggctcttcttccgccgctgctcccacctcttcctccgctgcttcccatgccgcctcttccgctgccgcctctgcttctcacgctgcttcttctgctgctgcttccaaggcttcttctgctgttgccgcccccaagtccgaggccgctgctggtgctcacgccactgccggtgccattgtctcccagatcaatgatggccagatccaggctccccactccaccggccctgcccaggcccccaaggcctctgctcctcccgcccaggccaacggcgctgccacccttggtgtctctgctgttgccggtgctgttgccgtcgccatgcttttctaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z