BBa_K1592004 1 Php4d promoter hp4d 2015-08-31T11:00:00Z 2015-09-18T09:25:27Z From our lab. The recombinant promotor hp4d, nearly unaffected by pH, carbon source, nitrogen source and some conditions, can strongly promote gene expression in any culture medium(Madzak et al., 2000). Promoter hp4d is composed of four tandem repeated UAS1 sequences in upstream and the small LEU2 promoter, which is the sequence between TATA box and start condon ATG of LEU2 promoter in downstream. UAS1 is the upsteam activating sequence of the pXPR2, which is less affected by other conditions. Though any inducers are non-essential for activiation of php4d during cultivating, hp4d, activated by unknown element, isn't constitutive promoter. The gene promoted by promoter hp4d usually expresses at the early stage of stabilization, called growth phase dependent (Nicaud et al., 2002). This feature, separating the strain growth and producing foreign protein, is useful for production of foreign protein, which avoids the harm by expressing foreign protein. false false _2009_ 20267 20267 9 false No. false Shuyan Tang annotation2441400 1 LEU range2441400 1 477 550 annotation2441398 1 UAS1-3 range2441398 1 242 350 annotation2441399 1 UAS1-4 range2441399 1 351 453 annotation2441396 1 UAS1-2 range2441396 1 133 241 annotation2441397 1 UAS1-1 range2441397 1 24 132 BBa_K1592004_sequence 1 atcgatacgcgtgcatgctgaggtgtctcacaagtgccgtgcagtcccgcccccacttgcttctctttgtgtgtagtgtacgtacattatcgagaccgttgttcccgcccacctcgatccggcatgctgaggtgtctcacaagtgccgtgcagtcccgcccccacttgcttctctttgtgtgtagtgtacgtacattatcgagaccgttgttcccgcccacctcgatccggcatgctgaggtgtctcacaagtgccgtgcagtcccgcccccacttgcttctctttgtgtgtagtgtacgtacattatcgagaccgttgttcccgcccacctcgatccggcatgctgaggtgtctcacaagtgccgtgcagtcccgcccccacttgcttctctttgtgtgtagtgtacgtacattatcgagaccgttgttcccgcccacctcgatccggcatgcactgatcacgggcaaaagtgcgtatatatacaagagcgtttgccagccacagattttcactccacacaccacatcacacatacaaccacacacatccaca igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z